Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU102911

Sigma-Aldrich

MISSION® esiRNA

targeting human RACK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGAGTGTGGCCTTCTCCTCTGACAACCGGCAGATTGTCTCTGGATCTCGAGATAAAACCATCAAGCTATGGAATACCCTGGGTGTGTGCAAATACACTGTCCAGGATGAGAGCCACTCAGAGTGGGTGTCTTGTGTCCGCTTCTCGCCCAACAGCAGCAACCCTATCATCGTCTCCTGTGGCTGGGACAAGCTGGTCAAGGTATGGAACCTGGCTAACTGCAAGCTGAAGACCAACCACATTGGCCACACAGGCTATCTGAACACGGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCCATGTTATGGGATCTCAACGAAGGCAAACACCTTTACACGCTAGATGGTGGGGACATCATCAACGCCCTGTGCTTCAGCCCTAACCGCTACTGGCTGTGTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000204628

numer dostępu NCBI

NM_006098

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... RACK1(10399) , GNB2L1(10399)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
NLU
GZT
QHS
DOR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Lei Zhang et al.
OncoTargets and therapy, 12, 1007-1020 (2019-02-19)
The expression and function of the Receptor for Activated C Kinase 1 (RACK1) in cancer growth and metastasis are confused in different cancers, especially in pancreatic ductal adenocarcinoma (PDAC). One-hundred and eighty-two PDAC tissue specimens (95 males and 87 females)
Yi Hu et al.
Cancer letters, 450, 144-154 (2019-03-09)
Receptor of activated protein kinase C 1 (RACK1) is downregulated in gastric cancer and is involved in modulating NF-κB signaling pathway activity. However, the underlying molecular mechanisms regulating RACK1 expression are unclear. In this study, we demonstrated that downregulated expression
Sujata Jha et al.
Nature, 546(7660), 651-655 (2017-06-22)
Ribosomes have the capacity to selectively control translation through changes in their composition that enable recognition of specific RNA elements. However, beyond differential subunit expression during development, evidence for regulated ribosome specification within individual cells has remained elusive. Here we
Wenting He et al.
Journal of Alzheimer's disease : JAD, 75(2), 451-460 (2020-04-07)
Accumulation of amyloid-β (Aβ) peptides, generated from amyloid-β precursor protein (AβPP) amyloidogenic processing, is one of the most salient disease hallmarks of Alzheimer's disease (AD). Nicotine is able to promote α-secretase-mediated AβPP nonamyloidogenic processing and increase the release of sAβPPα
Zhao-Fei Dong et al.
Molecular neurobiology, 50(2), 438-448 (2014-01-18)
Voltage-gated sodium channel α subunit type I (Nav1.1, encoded by SCN1A gene) plays a critical role in the initiation of action potential in the central nervous system. Downregulated expression of SCN1A is believed to be associated with epilepsy. Here, we
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej