Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU098081

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPA

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACAATCAACACCGTTCCAAAGGCCTGAAAATAATTTTCAGATAAAGAGACTCCAAGGTTGACTTTAGTTTGTGAGTTACTCATGTGACTATTTGAGGATTTTGAAAACATCAGATTTGCTGTGGTATGGGAGAAAAGGCTATGTACTTATTATTTTAGCTCTTTCTGTAATATTTACATTTTTTACCATATGTACATTTGTACTTTTATTTTACACATAAGGGAAAAAATAAGACCACTTTGAGCAGTTGCCTGGAAGGCTGGGCATTTCCATCATATAGACCTCTGCCCTTCAGAGTAGCCTCACCATTAGTGGCAGCATC

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mamoru Takada et al.
Cancer research, 77(18), 4881-4893 (2017-08-02)
The centromere regulates proper chromosome segregation, and its dysfunction is implicated in chromosomal instability (CIN). However, relatively little is known about how centromere dysfunction occurs in cancer. Here, we define the consequences of phosphorylation by cyclin E1/CDK2 on a conserved
S Zachary Swartz et al.
Developmental cell, 51(1), 35-48 (2019-08-20)
Centromeres provide a robust model for epigenetic inheritance as they are specified by sequence-independent mechanisms involving the histone H3-variant centromere protein A (CENP-A). Prevailing models indicate that the high intrinsic stability of CENP-A nucleosomes maintains centromere identity indefinitely. Here, we
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej