Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU097831

Sigma-Aldrich

MISSION® esiRNA

targeting human LPAR1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CAGGACCCAATACTCGGAGACTGACTGTTAGCACATGGCTCCTTCGTCAGGGCCTCATTGACACCAGCCTGACGGCATCTGTGGCCAACTTACTGGCTATTGCAATCGAGAGGCACATTACGGTTTTCCGCATGCAGCTCCACACACGGATGAGCAACCGGCGGGTAGTGGTGGTCATTGTGGTCATCTGGACTATGGCCATCGTTATGGGTGCTATACCCAGTGTGGGCTGGAACTGTATCTGTGATATTGAAAATTGTTCCAACATGGCACCCCTCTACAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000198121

numer dostępu NCBI

NM_001401

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... LPAR1(1902) , LPAR1(1902)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Przepraszamy, ale COA dla tego produktu nie jest aktualnie dostępny online.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Songbai Lin et al.
The American journal of pathology, 188(2), 353-366 (2017-11-13)
Intestinal epithelial cells form a barrier that is critical in protecting the host from the hostile luminal environment. Previously, we showed that lysophosphatidic acid (LPA) receptor 1 regulates proliferation of intestinal epithelial cells, such that the absence of LPA1 mitigates
Hui Ying Li et al.
Kidney international, 91(6), 1362-1373 (2017-01-24)
Lysophosphatidic acid (LPA) is known to regulate various biological responses by binding to LPA receptors. The serum level of LPA is elevated in diabetes, but the involvement of LPA in the development of diabetes and its complications remains unknown. Therefore
Huai-Bin Hu et al.
Nature communications, 12(1), 662-662 (2021-01-30)
Dynamic assembly and disassembly of primary cilia controls embryonic development and tissue homeostasis. Dysregulation of ciliogenesis causes human developmental diseases termed ciliopathies. Cell-intrinsic regulatory mechanisms of cilia disassembly have been well-studied. The extracellular cues controlling cilia disassembly remain elusive, however.
Debashish Sahay et al.
Oncotarget, 6(24), 20604-20620 (2015-06-23)
Lysophosphatidic acid (LPA) is a bioactive lipid promoting cancer metastasis. LPA activates a series of six G protein-coupled receptors (LPA1-6). While blockage of LPA1in vivo inhibits breast carcinoma metastasis, down-stream genes mediating LPA-induced metastasis have not been yet identified. Herein

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej