Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU095241

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR3 (1)

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTGTGCAGGTTCCGATGTTATTAGATGTTACAAGTTTATATATATCTATATATATAATTTATTGAGTTTTTACAAGATGTATTTGTTGTAGACTTAACACTTCTTACGCAATGCTTCTAGAGTTTTATAGCCTGGACTGCTACCTTTCAAAGCTTGGAGGGAAGCCGTGAATTCAGTTGGTTCGTTCTGTACTGTTACTGGGCCCTGAGTCTGGGCAGCTGTCCCTTGCTTGCCTGCAGGGCCATGGCTCAGGGTGGTCTCTTCTTGGGGCCCAGTGCATGGTGGCCAGAGGTGTCACCCAAACCG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000068078

numer dostępu NCBI

NM_000142

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FGFR3(2261) , FGFR3(2261)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
WDV
JUU
ZPU
OZT
NRR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Josine M Quispel-Janssen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(1), 84-94 (2017-10-25)
Purpose: Despite intense research, treatment options for patients with mesothelioma are limited and offer only modest survival advantage. We screened a large panel of compounds in multiple mesothelioma models and correlated sensitivity with a range of molecular features to detect
Xina Xie et al.
Experimental and therapeutic medicine, 18(2), 1226-1234 (2019-07-19)
Fibroblast growth factor receptor 3 (FGFR3) is a high frequency mutant gene in bladder cancer (BCa) and has become a promising therapeutic target due to its involvement in cell proliferation and migration. However, whether and how FGFR3 mutations affects BCa
Takeshi Okada et al.
Molecular neurobiology, 56(12), 8203-8219 (2019-06-17)
Neuronal apoptosis is a common and critical pathology following subarachnoid hemorrhage (SAH). We investigated the anti-apoptotic property of fibroblast growth factor (FGF)-2 after SAH in rats. A total of 289 rats underwent endovascular perforation to induce SAH or sham operation.
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.
V Tassinari et al.
Cell death & disease, 6, e1688-e1688 (2015-03-15)
Both fibroblast growth factor 9 (Fgf9) and Kit Ligand (Kl) signal through tyrosine kinase receptors, yet they exert opposite effects on meiotic differentiation in postnatal spermatogonia, Fgf9 acting as a meiosis-inhibiting substance and Kl acting as a promoter of the
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej