Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU093621

Sigma-Aldrich

MISSION® esiRNA

targeting human IQGAP3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGGCGTCTGCACTACTTCCAGAAGAATGTTAACTCCATTGTGAAGATCCAGGCATTTTTCCGAGCCAGGAAAGCCCAAGATGACTACAGGATATTAGTGCATGCACCCCACCCTCCTCTCAGTGTGGTACGCAGATTTGCCCATCTCTTGAATCAAAGCCAGCAAGACTTCTTGGCTGAGGCAGAGCTGCTGAAGCTCCAGGAAGAGGTAGTTAGGAAGATCCGATCCAATCAGCAGCTGGAGCAGGACCTCAACATCATGGACATCAAGATTGGCCTGCTGGTGAAGAACCGGATCACTCTGCAGGAAGTGGTCTCCCACTGCAAGAAGCTGACCAAGAGGAATAAGGAACAGCTGTCAGATATGATGGTTCTGGACAAGCAGAAGGGTTTAAAGTCGCTGAGCAAAGAGAAACGGCAGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000183856

numer dostępu NCBI

NM_178229

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IQGAP3(128239) , IQGAP3(128239)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yongjie Shi et al.
Journal of translational medicine, 15(1), 176-176 (2017-08-16)
Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide owing to its high rates of metastasis and recurrence. The oncogene IQ motif-containing GTPase activating protein 3 (IQGAP3) is ubiquitously overexpressed in several human cancers, including liver, ovary, lung
Naohide Oue et al.
Pathobiology : journal of immunopathology, molecular and cellular biology, 85(3), 192-200 (2017-11-14)
Spheroid colony formation is a useful method of cancer stem cell (CSC) characterization. We previously showed that the IQ motif containing the GTPase-activating protein 3 gene (IQGAP3) is upregulated in spheroid body-forming gastric cancer (GC) cells compared with parental cells.
Chase J Morgan et al.
Scientific reports, 9(1), 11057-11057 (2019-08-01)
The Ras family of small GTPases modulates numerous essential processes. Activating Ras mutations result in hyper-activation of selected signaling cascades, which leads to human diseases. The high frequency of Ras mutations in human malignant neoplasms has led to Ras being

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej