Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU091861

Sigma-Aldrich

MISSION® esiRNA

targeting human ENG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CATGCAGATCTGGACCACTGGAGAATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGTAGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGAAAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGAGGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000106991

numer dostępu NCBI

NM_000118

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ENG(2022) , ENG(2022)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Shoumei Bai et al.
Cancers, 11(11) (2019-11-07)
: Most high-grade serous ovarian cancers (HGSCs) initiate from the fallopian tube epithelium and then metastasize to the ovary and throughout the abdomen. Genomic analyses suggest that most HGSCs seed the ovary prior to abdominal dissemination. Similarly, animal models support
Elisa Rossi et al.
Cellular and molecular life sciences : CMLS, 73(8), 1715-1739 (2015-12-10)
The circulatory system is walled off by different cell types, including vascular mural cells and podocytes. The interaction and interplay between endothelial cells (ECs) and mural cells, such as vascular smooth muscle cells or pericytes, play a pivotal role in
Krishnendu Pal et al.
Molecular cancer therapeutics, 13(10), 2264-2275 (2014-08-16)
Endoglin, a 180-kDa disulfide-linked homodimeric transmembrane receptor protein mostly expressed in tumor-associated endothelial cells, is an endogenous binding partner of GAIP-interacting protein, C terminus (GIPC). Endoglin functions as a coreceptor of TβRII that binds TGFβ and is important for vascular
Priyanka Singh et al.
Cancer research, 78(11), 2978-2989 (2018-03-15)
Inhibin is a heterodimeric TGFβ family ligand that is expressed in many cancers and is a selective biomarker for ovarian cancers; however, its tumor-specific functions remain unknown. Here, we demonstrate that the α subunit of inhibin (INHA), which is critical
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej