Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU091361

Sigma-Aldrich

MISSION® esiRNA

targeting human MRE11

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCCTCTGTAAAAAGATCCCTGAGATTATTCCTTCTTCTAGTTTTATGCGACAGCTTTACTTTAAAATTCAAGTTATACATCTTGGGAGTACAATGGCCCGACATTTCTTCATAGGTAGAAACAAATACTTGACTCAGTGATACTCATGACCATTAGAATAGTCATACCTGGAATGTGTCAAATTATAAGAGACAGACACTTGGTTAGTGGCTGCCTCATATAGCACTTTTGAAGAGGCCTAAGTCAAAACTTGCAATATAACATTCTATTGACTTTCTTAAAAATATTTTTTCTGTACCTAACTTGAGCATAAGGGTTATTTGAGCAAGTAACATTAACTCAGTGGAAGGCATTGTCCTGTGAAATATTCTTAGGCAGATCTGCCCACATCTTTATTGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000020922

numer dostępu NCBI

NM_005591

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MRE11(4361) , MRE11A(4361)

Powiązane kategorie

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Działania biochem./fizjol.

MRE11A (meiotic recombination 11 homolog A) is a nuclease which forms complex with Rad50 (DNA repair protein) and Nbs1 (nijmegen breakage syndrome protein 1). This complex works as a sensor of DNA double strand breaks, and is involved in DNA repair processes and DNA damage response. Absence of the complex activity causes developmental and/or degenerative neuronal disorders. In homologous recombination repair, MRE11A is responsible for the 3′-to-5′ exonuclease activity, leading to the generation of protruding 3′ ssDNA at double strand breaks. MRE11A is also an oncoprotein which is associated with colorectal cancer and malignant breast cancer. Hypomorphic mutations in this gene leads to Ataxia-Telangiectasia like disorder.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
DAV
ACIU
TTU
GTU
QCS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Rad51 recombinase prevents Mre11 nuclease-dependent degradation and excessive PrimPol-mediated elongation of nascent DNA after UV irradiation.
Vallerga MB
Proceedings of the National Academy of Sciences of the USA, 112, E6624-E6624 (2015)
Interaction of MRE11 and Clinicopathologic Characteristics in Recurrence of Breast Cancer: Individual and Cumulated Receiver Operating Characteristic Analyses.
Yang CH
BioMed Research International, 2017, 2563910-2563910 (2017)
M Petroni et al.
Cell death and differentiation, 23(2), 197-206 (2015-06-13)
The MRE11/RAD50/NBS1 (MRN) complex is a major sensor of DNA double strand breaks, whose role in controlling faithful DNA replication and preventing replication stress is also emerging. Inactivation of the MRN complex invariably leads to developmental and/or degenerative neuronal defects
A Bakr et al.
Nucleic acids research, 43(6), 3154-3166 (2015-03-11)
Ataxia-telangiectasia mutated (ATM) is needed for the initiation of the double-strand break (DSB) repair by homologous recombination (HR). ATM triggers DSB end resection by stimulating the nucleolytic activity of CtIP and MRE11 to generate 3'-ssDNA overhangs, followed by RPA loading
Ying Wai Chan et al.
Nature cell biology, 20(1), 92-103 (2017-12-20)
The resolution of joint molecules that link recombining sister chromatids is essential for chromosome segregation. Here, we determine the fate of unresolved recombination intermediates arising in cells lacking two nucleases required for resolution (GEN1 -/- knockout cells depleted of MUS81).

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej