Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU089961

Sigma-Aldrich

MISSION® esiRNA

targeting human LYN

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAGAGGGAATGGCATACATCGAGCGGAAGAACTACATTCACCGGGACCTGCGAGCAGCTAATGTTCTGGTCTCCGAGTCACTCATGTGCAAAATTGCAGATTTTGGCCTTGCTAGAGTAATTGAAGATAATGAGTACACAGCAAGGGAAGGTGCTAAGTTCCCTATTAAGTGGACGGCTCCAGAAGCAATCAACTTTGGATGTTTCACTATTAAGTCTGATGTGTGGTCCTTTGGAATCCTCCTATACGAAATTGTCACCTATGGGAAAATTCCCTACCCAGGGAGAACTAATGCCGACGTGATGACCGCCCTGTCCCAGGGCTACAGGATGCCCCGTGTGGAGAACTGCCCAGATGAGCTCTATGACATTATGAAAATGTGCTGGAAAGAAAAGGCAG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Shuaibin Liu et al.
Oncotarget, 7(46), 75468-75481 (2016-10-01)
Cervical cancer is one of the most common malignant tumor in women. The mechanisms of cervical cancer are intricate and have not been fully understood. Therefore, we employed iTRAQ to obtain novel proteins profile which participates in the tumor oncogenesis
Xiaoyun Wang et al.
Scientific reports, 7, 42675-42675 (2017-02-17)
Hypersecretion of mucus is an important component of airway remodeling and contributes to the mucus plugs and airflow obstruction associated with severe asthma phenotypes. Lyn has been shown to down-regulate allergen-induced airway inflammation. However, the role of Lyn in mucin
Lei Meng et al.
Acta biochimica et biophysica Sinica, 52(1), 49-57 (2019-12-13)
Gastric cancer (GC) is one of malignant tumors with high mortality and morbidity in the world. MicroRNA-122 (miR-122) acts as a tumor suppressor in a variety of cancers and has been found to be dominant in gastric adenocarcinoma. However, the
Ruifang Wu et al.
The Journal of clinical investigation, 128(6), 2551-2568 (2018-05-15)
Immune imbalance of T lymphocyte subsets is a hallmark of psoriasis, but the molecular mechanisms underlying this aspect of psoriasis pathology are poorly understood. Here, we report that microRNA-210 (miR-210), a miR that is highly expressed in both psoriasis patients
D Thaper et al.
Oncogene, 36(28), 3964-3975 (2017-03-14)
The acquisition of an invasive phenotype by epithelial cells occurs through a loss of cellular adhesion and polarity, heralding a multistep process that leads to metastatic dissemination. Since its characterization in 1995, epithelial-mesenchymal transition (EMT) has been closely linked to

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej