Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU086811

Sigma-Aldrich

MISSION® esiRNA

targeting human SYT1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCCATATAGTGCTCTTTAGCCAGTATCTGTAAATACCTCAGTAATATGGGTCCTTTCATTTTTCCAGCCATGCATTCCTAACACAATTCAGTGGTACTTGGAATCCTGTTTTAATTTGCACAAATTTAAATGTAGAGAGCCCCTAAGTCCTTCATCATACCACTGCCCTCCAAATCTACTCTTCTTTTAAGCAATATGATGTGTAGATAGAGCATGAATGAAATTATTTATTGTATCACACTGTTGTATATACCAGTATGCTAAAGATTTATTTCTAGTTTGTGTATTTGTATGTTGTAAGCGTTTCCTAATCTGTGTATATCTAGATGTTTTTAATAAGATGTTCTATTTTAAACTATGTAAATTGACTGAGATATAGGAGAGCTGATAATATATTATACGGTAAATATAGTATCGTCTGCATTCCAGCA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Przepraszamy, ale COA dla tego produktu nie jest aktualnie dostępny online.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Feng Xu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 46(2), 699-712 (2018-04-06)
Necroptosis, a form of programmed necrosis, is involved in the pathologic process of several kinds of pulmonary diseases. However, the role of necroptosis in particulate matter (PM)-induced pulmonary injury remains unclear. The objective of this study is to investigate the
Yang Xiao et al.
Biochimica et biophysica acta. Molecular basis of disease, 1864(5 Pt A), 1728-1743 (2018-02-25)
Diabetic cardiomyopathy is associated with suppressed autophagy and augmented inflammation in the heart. The effects of Tax1 binding protein 1 (TAX1BP1) on both autophagy and inflammation suggest that it may participate in the progression of diabetic cardiomyopathy. Mice were injected
Changping Gu et al.
Shock (Augusta, Ga.), 44(1), 83-89 (2015-03-24)
Recombinant human annexin A5 (Anx5) is known to protect cardiac function during endotoxemia, although the underlying mechanisms have yet to be elucidated. In this study, we demonstrated that Anx5 could repair the disrupted cardiomyocyte adherens junctions and improve the myocardial
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Y Loriot et al.
Cell death & disease, 5, e1423-e1423 (2014-09-19)
Radiotherapy has a critical role in the treatment of small-cell lung cancer (SCLC). The effectiveness of radiation in SCLC remains limited as resistance results from defects in apoptosis. In the current study, we investigated whether using the Bcl-2/Bcl-XL inhibitor S44563

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej