Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU085901

Sigma-Aldrich

MISSION® esiRNA

targeting human GLS (2)

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGAAAAGAGCCGAGTGGACTAAGATTCAACAAACTATTTTTGAATGAAGATGATAAACCACATAATCCTATGGTAAATGCTGGAGCAATTGTTGTGACTTCACTAATAAAGCAAGGAGTAAATAATGCTGAAAAATTTGACTATGTCATGCAGTTTTTGAATAAGATGGCTGGTAATGAATATGTTGGATTCAGTAATGCAACGTTTCAGTCTGAAAGAGAAAGTGGAGATCGAAATTTTGCAATAGGATATTACTTAAAAGAAAAGAAGTGTTTTCCAGAAGGCACAGACATGGTTGGTATATTAGACTTCTACTTCCAGCTGTGCTCCATTGAAGTGACTTGTGAATCAGCCAGTGTGATGGCTGCGACACTGGCTAATGGTGGTTTCTGCCCAATTACTGGTGAAAGAGTACTGAGCCCTGAAGCAGTTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000115419

numer dostępu NCBI

NM_014905

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GLS(2744) , GLS(2744)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Denis A Mogilenko et al.
Cell, 177(5), 1201-1216 (2019-04-30)
Innate immune responses are intricately linked with intracellular metabolism of myeloid cells. Toll-like receptor (TLR) stimulation shifts intracellular metabolism toward glycolysis, while anti-inflammatory signals depend on enhanced mitochondrial respiration. How exogenous metabolic signals affect the immune response is unknown. We
Jae-Seon Lee et al.
Biochemical and biophysical research communications, 477(3), 374-382 (2016-06-25)
We found that non-small cell lung cancer (NSCLC) is remarkably sensitive to the regulation of glutamine supply by testing the metabolic dependency of 11 cancer cell lines against regulation of glycolysis, autophagy, fatty acid synthesis, and glutamine supply. Glutamine is
Lisha Xiang et al.
Cell death & disease, 10(2), 40-40 (2019-01-25)
Cancer cells re-program their metabolic machinery to meet the requirements of malignant transformation and progression. Glutaminase 1 (GLS1) was traditionally known as a mitochondrial enzyme that hydrolyzes glutamine into glutamate and fuels rapid proliferation of cancer cells. However, emerging evidence
Xuan Qu et al.
Biochemical and biophysical research communications, 504(2), 415-421 (2018-08-15)
Oncogenic c-Myc-induced metabolic reprogramming triggers cellular dependency on exogenous glucose and glutamine. Understanding how nutrients are used may provide new target for therapeutic intervention. We previously provided an alternate route to c-Myc-driven glucose metabolism via the repression of thioredoxin-interacting protein
Yuta Mizuno et al.
Oncology letters, 19(4), 2934-2942 (2020-03-29)
The high expression of metabolic enzymes, including glutaminase (GA) and lactate dehydrogenase A (LDHA), which contribute to bioenergetics and biosynthesis of mammalian cells, has been identified in a variety of cancer types. The current study indicated intratumoral heterogeneity with respect
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej