Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU083931

Sigma-Aldrich

MISSION® esiRNA

targeting human ZBTB16

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCACCCCTACGAGTGTGAGTTCTGTGGCAGCTGCTTCCGGGATGAGAGCACACTCAAGAGCCACAAACGCATCCACACGGGTGAGAAACCCTACGAGTGCAATGGCTGTGGCAAGAAGTTCAGCCTCAAGCATCAGCTGGAGACGCACTATAGGGTGCACACAGGTGAGAAGCCCTTTGAGTGTAAGCTCTGCCACCAGCGCTCCCGGGACTACTCGGCCATGATCAAGCACCTGAGAACGCACAACGGCGCCTCGCCCTACCAGTGCACCATCTGCACAGAGTACTGCCCCAGCCTCTCCTCCATGCAGAAGCACATGAAGGGCCACAAGCCCGAGGAGATCCCGCCCGACTGGAGGATAGAGAAGACGTACCTCTACCTGTGCTATGTGTGAAGGGAGGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000109906

numer dostępu NCBI

NM_006006

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... ZBTB16(7704) , ZBTB16(7704)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Wencong Song et al.
Journal of cellular biochemistry, 116(10), 2155-2165 (2015-03-27)
The balance between the self-renewal and differentiation of male germline stem cells (mGSCs) is critical for the initiation and maintenance of mammalian spermatogenesis. The promyelocytic leukemia zinc finger (PLZF), a zinc finger protein, is a critical factor for maintaining the
Wencheng Kong et al.
Aging, 12(23), 24009-24022 (2020-11-23)
Peritoneal metastasis (PM) is the main cause of poor prognosis in patients with advanced gastric cancer (GC). Increasing evidence has suggested that cancer-associated EVs in body fluids may assist in the diagnosis and treatment of GC. Here, we investigated the
Yung-Ho Hsu et al.
PloS one, 7(1), e30674-e30674 (2012-02-01)
Many studies suggest that far-infrared (FIR) therapy can reduce the frequency of some vascular-related diseases. The non-thermal effect of FIR was recently found to play a role in the long-term protective effect on vascular function, but its molecular mechanism is
Julien M D Legrand et al.
Nature communications, 10(1), 2278-2278 (2019-05-28)
Mammalian spermatogenesis is sustained by mitotic germ cells with self-renewal potential known as undifferentiated spermatogonia. Maintenance of undifferentiated spermatogonia and spermatogenesis is dependent on tightly co-ordinated transcriptional and post-transcriptional mechanisms. The RNA helicase DDX5 is expressed by spermatogonia but roles

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej