Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU070821

Sigma-Aldrich

MISSION® esiRNA

targeting human PDCD4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AATGAAGTTGCGGAAATGTTAAGAGATTTAAATCTTGGTGAAATGAAAAGTGGAGTACCAGTGTTGGCAGTATCCTTAGCATTGGAGGGGAAGGCTAGTCATAGAGAGATGACATCTAAGCTTCTTTCTGACCTTTGTGGGACAGTAATGAGCACAACTGATGTGGAAAAATCATTTGATAAATTGTTGAAAGATCTACCTGAATTAGCACTGGATACTCCTAGAGCACCACAGTTGGTGGGCCAGTTTATTGCTAGAGCTGTTGGAGATGGAATTTTATGTAATACCTATATTGATAGTTACAAAGGAACTGTAGATTGTGTGCAGGCTAGAGCTGCTCTGGATAAGGCTACCGTGCTTCTGAGTATGTCTAAAGGTGGAAAGCGTAAAGATAGTGTGTGGGGCTCTGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000150593

numer dostępu NCBI

NM_014456

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PDCD4(27250) , PDCD4(27250)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
BBV
QCS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Kun Wang et al.
Molecular medicine reports, 16(5), 6757-6763 (2017-09-14)
Contrast medium (CM) is widely used in cardiac catheterization; however, it may induce acute kidney injury or renal failure, although the underlying mechanism remains to be elucidated. MicroRNA‑21 (miR‑21) is involved in renal disease and has been indicated to regulate
Hongwei Liang et al.
Scientific reports, 6, 23772-23772 (2016-03-30)
Programmed cell death 4 (PDCD4), as a tumor suppressor gene, is frequently reduced in a variety of tumors, including gastric cancer. Previous findings have indicated that PDCD4 participates in tumorigenesis through the regulation of apoptosis, but the molecular basis of
Xiaodong Chen et al.
Anatomical record (Hoboken, N.J. : 2007), 302(8), 1399-1408 (2018-10-20)
Osteosarcoma (OS) is one of the most common malignancies of bone. This study was aimed to explore the anti-metastatic effect of euxanthone on OS. Adhesion assay and Transwell assay were used to examine the effect of euxanthone on adhesion, migration
Ken Watanabe et al.
PloS one, 15(2), e0226053-e0226053 (2020-02-11)
Hypertension is a major public health problem among the aging population worldwide. It causes cardiac remodeling, including hypertrophy and interstitial fibrosis, which leads to development of hypertensive heart disease (HHD). Although microRNA-21 (miR-21) is associated with fibrogenesis in multiple organs
Xiafei Fu et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 670-682 (2018-07-20)
Several miRNAs have been reported to be involved in the pathogenesis of polycystic ovarian syndrome (PCOS). However, the biological roles of miR-16 and its molecular mechanisms in PCOS development remain to be elucidated. qRT-PCR was performed to detect the expression
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej