Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU070111

Sigma-Aldrich

MISSION® esiRNA

targeting human CCNE1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATCCTCCAAAGTTGCACCAGTTTGCGTATGTGACAGATGGAGCTTGTTCAGGAGATGAAATTCTCACCATGGAATTAATGATTATGAAGGCCCTTAAGTGGCGTTTAAGTCCCCTGACTATTGTGTCCTGGCTGAATGTATACATGCAGGTTGCATATCTAAATGACTTACATGAAGTGCTACTGCCGCAGTATCCCCAGCAAATCTTTATACAGATTGCAGAGCTGTTGGATCTCTGTGTCCTGGATGTTGACTGCCTTGAATTTCCTTATGGTATACTTGCTGCTTCGGCCTTGTATCATTTCTCGTCATCTGAATTGATGCAAAAGGTTTCAGGGTATCAGTGGTGCGACATAGAGAACTGTGTCAAGTGGATGGTTCCATTTGCCATGGTTATAAGGGAGACGGGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000105173

numer dostępu NCBI

NM_001238

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CCNE1(898) , CCNE1(898)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
SDV
XBV
FRU
DQU
FPT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ran Wei et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 38(9), 1952-1964 (2020-03-13)
While amplified expressed cyclin E1 is a well-known tumorigenic factor and prognostic biomarker in several malignancies, its prognostic predictive potential and function in osteosarcoma is poorly understood. Here we reveal discrete expression pattern, correlation to clinicopathological characteristics and prognosis and
Caishang Zheng et al.
Scientific reports, 7(1), 16422-16422 (2017-11-29)
Enterovirus 71 (EV71) is the predominant causative pathogen of hand-foot-and-mouth disease (HFMD). Contrary to other HFMD-causing enterovirus, EV71 can lead to severe neurological complications, even death. MicroRNAs (miRNAs) are small non-coding RNAs that constitute the largest family of gene regulators
X Zhang et al.
Neoplasma, 66(5), 704-716 (2019-05-28)
Previous studies have reported that miR-107 could be utilized as a potential peripheral biomarker in prostate cancer (PCa). However, the specific functions of miR-107 in prostate cancer and its relevant mechanisms are still unknown. The aim of this research was
Wei-Wei Liu et al.
Cancer management and research, 13, 439-447 (2021-01-28)
To explore the regulatory role of miR497-5p-CCNE1 axis in triple-negative breast cancer (TNBC) cells and its predictive value for early diagnosis. Cancer tissue and adjacent tissue samples were collected from 86 patients with TNBC.RT-PCR was used to detect the expression
Jingjing Liu et al.
Cell cycle (Georgetown, Tex.), 17(3), 309-318 (2017-12-13)
An accumulated evidence supports that MicroRNAs (miRNAs) have shown a prominent role in pathological processes and different tumor onset. However, to date, the potential functional roles and molecular mechanisms by how microRNA-424-5p(miR-424-5p) affects cancer cell proliferation are greatly unclear, especially
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej