Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU068681

Sigma-Aldrich

MISSION® esiRNA

targeting human PTK2B

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGGGAGGTCTATGAAGGTGTCTACACAAATCACAAAGGGGAGAAAATCAATGTAGCTGTCAAGACCTGCAAGAAAGACTGCACTCTGGACAACAAGGAGAAGTTCATGAGCGAGGCAGTGATCATGAAGAACCTCGACCACCCGCACATCGTGAAGCTGATCGGCATCATTGAAGAGGAGCCCACCTGGATCATCATGGAATTGTATCCCTATGGGGAGCTGGGCCACTACCTGGAGCGGAACAAGAACTCCCTGAAGGTGCTCACCCTCGTGCTGTACTCACTGCAGATATGCAAAGCCATGGCCTACCTGGAGAGCATCAACTGCGTGCACAGGGACATTGCTGTCCGGAACATCCTGGTGGCCTCCCCTGAGTGTGTGAAGCTGGGGGACTTTGGTCTTTCCCGGTACA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000120899

numer dostępu NCBI

NM_004103

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PTK2B(2185) , PTK2B(2185)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jialin Qian et al.
Oncology letters, 11(3), 1738-1744 (2016-03-22)
Lung cancer, specifically non-small cell lung cancer (NSCLC), is the leading cause of cancer-associated mortality in the world. In previous years, almost no significant advancements have been made towards the molecular characterization of NSCLC, which highlights the requirement for novel
Chien-Chung Yang et al.
International journal of molecular sciences, 21(1) (2020-01-08)
Neuroinflammation is a landmark of neuroinflammatory and neurodegenerative diseases. Matrix metalloproteinase (MMP)-9, one member of MMPs, has been shown to contribute to the pathology of these brain diseases. Several experimental models have demonstrated that lipopolysaccharide (LPS) exerts a pathological role
Shaymaa Ik Al-Juboori et al.
Journal of experimental & clinical cancer research : CR, 38(1), 210-210 (2019-05-24)
Metformin, a biguanide, is one of the most commonly prescribed treatments for type 2 diabetes and has recently been recommended as a potential drug candidate for advanced cancer therapy. Although Metformin has antiproliferative and proapoptotic effects on breast cancer, the
Chih-Chung Lin et al.
Frontiers in molecular neuroscience, 10, 387-387 (2017-12-07)
Neurodegenerative disorders and brain damage are initiated by excessive production of reactive oxygen species (ROS), which leads to tissue injury, cellular death and inflammation. In cellular anti-oxidant systems, heme oxygenase-1 (HO-1) is an oxidative-sensor protein induced by ROS generation or
Qiaoqiao Wan et al.
Scientific reports, 7(1), 9033-9033 (2017-08-24)
Focal adhesion kinase (FAK) and Src family kinases (SFK) are known to play critical roles in mechanotransduction and other crucial cell functions. Recent reports indicate that they reside in different microdomains of the plasma membrane. However, little is known about
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej