Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU065671

Sigma-Aldrich

MISSION® esiRNA

targeting human HNRNPK

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACCCAGAACGCTTCAGTTCTGCTCTGCAAGGATATATAATAACTGATTGGTGTGCCCGTTTAATAAAAGAATATGGAAACTGAACAGCCAGAAGAAACCTTCCCTAACACTGAAACCAATGGTGAATTTGGTAAACGCCCTGCAGAAGATATGGAAGAGGAACAAGCATTTAAAAGATCTAGAAACACTGATGAGATGGTTGAATTACGCATTCTGCTTCAGAGCAAGAATGCTGGGGCAGTGATTGGAAAAGGAGGCAAGAATATTAAGGCTCTCCGTACAGACTACAATGCCAGTGTTTCAGTCCCAGACAGCAGTGGCCCCGAGCGCATATTGAGTATCAGTGCTGATATTGAAACAATTGGAGAAATTCTGAAGAAAATCATCCCTACCTTGGAAGAGGGCCTGCAGTTGCCATCACCCACTGCAACCAGCCAGCTCCCGCTCGAATCTGATGCTGTGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000165119

numer dostępu NCBI

NM_031262

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... HNRNPK(3190) , HNRNPK(3190)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
BBV
VOU
PXT
UPS
QAS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Taiyo Otoshi et al.
PloS one, 10(12), e0145769-e0145769 (2015-12-30)
Heterogeneous nuclear ribonucleoprotein (hnRNP) K is a part of the ribonucleoprotein complex which regulates diverse biological events. While overexpression of hnRNP K has been shown to be related to tumorigenesis in several cancers, both the expression patterns and biological mechanisms
Agata Swiatkowska et al.
RNA biology, 17(10), 1402-1415 (2020-05-26)
The p53 protein is one of the transcription factors responsible for cell cycle regulation and prevention of cancer development. Its expression is regulated at the transcriptional, translational and post-translational levels. Recent years of research have shown that the 5' terminus
Xue Gong et al.
Oncotarget, 8(12), 18657-18669 (2017-04-21)
Clear cell renal cell carcinomas (ccRCC) show a broad range of clinical behavior, and prognostic biomarkers are needed to stratify patients for appropriate management. We sought to determine whether long intergenic non-coding RNAs (lincRNAs) might predict patient survival. Candidate prognostic
Diane Moujalled et al.
Human molecular genetics, 26(9), 1732-1746 (2017-03-24)
TAR DNA binding protein 43 (TDP-43) is a major disease-associated protein involved in the pathogenesis of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration with ubiquitin-positive inclusions (FTLD-U). Our previous studies found a direct association between TDP-43 and heterogeneous nuclear
David Colognori et al.
Molecular cell, 74(1), 101-117 (2019-03-05)
During X-inactivation, Xist RNA spreads along an entire chromosome to establish silencing. However, the mechanism and functional RNA elements involved in spreading remain undefined. By performing a comprehensive endogenous Xist deletion screen, we identify Repeat B as crucial for spreading Xist
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej