Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU064831

Sigma-Aldrich

MISSION® esiRNA

targeting human IFT88

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATTATGAGAAGGCCGCTGAATTCTATAAAGAGGCTCTAAGAAATGATTCTTCTTGTACTGAAGCACTTTATAATATTGGCCTTACCTATGAGAAACTAAATCGGCTAGATGAGGCTTTGGACTGTTTCCTGAAACTTCACGCAATCCTACGAAACAGTGCCGAAGTTCTTTACCAGATAGCAAATATATATGAATTAATGGAAAATCCCAGTCAAGCTATTGAATGGCTAATGCAGGTGGTCAGTGTTATTCCAACCGATCCTCAAGTTTTATCTAAGCTAGGAGAATTATATGATCGTGAAGGAGATAAATCTCAAGCATTTCAATATTACTATGAGTCATATAGGTATTTTCCTTGTAATATTGAAGTCATTGAGTGGCTTGGAGCCTATTACATTGACACCCAATTTTGGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000032742

numer dostępu NCBI

NM_175605

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IFT88(8100) , IFT88(8100)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Qike Huang et al.
Cancer letters, 402, 52-60 (2017-05-26)
Determining the origin of liver cancer stem cells is important for treating hepatocellular carcinoma. Tg737 deficiency plays an important role in the malignant transformation of liver stem cells, but the underlying mechanism remains unclear. Here we established a chemical-induced mouse
Matthew E Deren et al.
International journal of molecular sciences, 17(2), 188-188 (2016-02-11)
Chondroprogenitors and hypertrophic chondrocytes, which are the first and last stages of the chondrocyte differentiation process, respectively, are sensitive to mechanical signals. We hypothesize that the mechanical sensitivity of these cells depends on the cell surface primary cilia. To test
Daolu Zhan et al.
Molecular medicine reports, 16(5), 6590-6599 (2017-09-14)
Intraflagellar transport protein 88 (IFT88) is protein crucial for the assembly and maintenance of primary cilia in chondrocytes. Primary cilia regulate mechanical and chemical signals in chondrocytes; however, the effects of cytokines on IFT88 expression and cilia formation and maintenance
Chia-Yih Wang et al.
The Journal of physiology, 597(12), 3069-3083 (2019-04-27)
Endocrine gland-derived vascular endothelial growth factor (EG-VEGF) is a critical factor that facilitates trophoblast invasion in placenta. Plasma miR-141 and miR-200a levels were elevated, while EG-VEGF was decreased in peripheral blood and placenta of preeclamptic patients. Furthermore, numbers of cilia
Wengui Shi et al.
Scientific reports, 7(1), 1866-1866 (2017-05-14)
It is well documented that microgravity in space environment leads to bone loss in astronauts. These physiological changes have also been validated by human and animal studies and modeled in cell-based analogs. However, the underlying mechanisms are elusive. In the
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej