Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU063971

Sigma-Aldrich

MISSION® esiRNA

targeting human CALCR

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCCTGCAACTATTTCTGGATGCTCTGTGAAGGGATCTATCTTCATACACTCATTGTCGTGGCTGTGTTTACTGAGAAGCAACGCTTGCGGTGGTATTATCTCTTGGGCTGGGGGTTCCCGCTGGTGCCAACCACTATCCATGCTATTACCAGGGCCGTGTACTTCAATGACAACTGCTGGCTGAGTGTGGAAACCCATTTGCTTTACATAATCCATGGACCTGTCATGGCGGCACTTGTGGTCAATTTCTTCTTTTTGCTCAACATTGTCCGGGTGCTTGTGACCAAAATGAGGGAAACCCATGAGGCGGAATCCCACATGTACCTGAAGGCTGTGAAGGCCACCATGATCCTTGTGCCCCTGCTGGGAATCCAGTTTGTCGTCTTTCCCTGGAGACCTTCCAACAAGATGCTTGGGAAGATATATGATTACGTGATGCACTCTCTGATTCATTTCCAGGGCTTCTTTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000004948

numer dostępu NCBI

NM_001742

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CALCR(799) , CALCR(799)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Barbara Toffoli et al.
Clinical science (London, England : 1979), 134(17), 2337-2352 (2020-08-29)
TNF-related apoptosis-inducing ligand (TRAIL) has attracted attention not only as an anti-cancer agent, but also as a potential treatment for diabetes. Animal studies have shown that TRAIL delivery ameliorated glucose control in type 1 and type 2 diabetes. It is
Ruo Feng et al.
Diagnostic pathology, 10, 149-149 (2015-08-27)
Hepatocellular carcinoma (HCC) is one of the most frequent cancers in the world. Calreticulin(CRT) is aberrantly overexpressed in many human cancer cells. The function of CRT in HCC cells remains unclear. We attempted to investigate the effects and the underlying
Saurabh Vig et al.
Cell cycle (Georgetown, Tex.), 14(14), 2274-2284 (2015-05-07)
Calreticulin (CRT) is an endoplasmic reticulum (ER) resident calcium binding protein that is involved in several cellular activities. Transcriptome analyses in CRT knockdown HepG2 cells revealed 253 altered unique genes and subsequent in silico protein-protein interaction network and MCODE clustering
Beatrice Rondinelli et al.
Nucleic acids research, 43(5), 2560-2574 (2015-02-26)
DNA replication is a tightly regulated process that initiates from multiple replication origins and leads to the faithful transmission of the genetic material. For proper DNA replication, the chromatin surrounding origins needs to be remodeled. However, remarkably little is known
Xuemin Wang et al.
PloS one, 10(4), e0125402-e0125402 (2015-05-01)
Cisplatin is one of the first-line platinum-based chemotherapeutic agents for treatment of many types of cancer, including ovary cancer. CTR1 (copper transporter 1), a transmembrane solute carrier transporter, has previously been shown to increase the cellular uptake and sensitivity of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej