Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU063491

Sigma-Aldrich

MISSION® esiRNA

targeting human ELAVL1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCGTCACCAATGTGAAAGTGATCCGCGACTTCAACACCAACAAGTGCAAAGGGTTTGGCTTTGTGACCATGACAAACTATGAAGAAGCCGCGATGGCCATAGCCAGCCTGAACGGCTACCGCCTGGGGGACAAAATCTTACAGGTTTCCTTCAAAACCAACAAGTCCCACAAATAACTCGCTCATGCTTTTTTTTGTACGGAATAGATAATTAAGAGTGAAGGAGTTGAAACTTTTCTTGTTAGTGTACAACTCATTTTGCGCCAATTTTCACAAGTGTTTGTCTTTGTCTGAATGAGAAGTGAGAAGGTTTTTATACTCTGGGATGCAACCGACATGTTCAAATGTTTGAAATCCCACAATGTTAGACCAATCTTAAGTTTCGTAAGTTATTTCCTTTAAGATATATATTAAACAGAAATCTAAGTAGAACTGCATTGACTAACCAGTCCCTCTGGATGGTGGTGAACCT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Guillaume Gauchotte et al.
The Journal of pathology, 242(4), 421-434 (2017-05-12)
HuR regulates cytoplasmic mRNA stability and translatability, and the HuR expression level has been shown to correlate with poor disease outcome in several cancer types; however, the prognostic value and potential pro-oncogenic properties of HuR in meningioma remain unclear. Thus
Kotb Abdelmohsen et al.
RNA biology, 14(3), 361-369 (2017-01-13)
HuR influences gene expression programs and hence cellular phenotypes by binding to hundreds of coding and noncoding linear RNAs. However, whether HuR binds to circular RNAs (circRNAs) and impacts on their function is unknown. Here, we have identified en masse
Shuran Li et al.
Science China. Life sciences, 60(6), 617-626 (2017-06-25)
APOBEC3 protein families, a DNA cytidine deaminase, were up-regulated in multiple tumors. However, the relationship between Hepatocellular carcinoma (HCC) and APOBEC3B (A3B) remains unknown. It has been confirmed that interleukin-6 (IL-6) has significant impacts on oncogenesis of HCC. Here, we
Sun Kyoung Lee et al.
Scientific reports, 7(1), 9610-9610 (2017-08-31)
Breast cancer mainly spreads to bone, causing decreased survival of patient. Human antigen R (HuR) and chemokines are important molecules associated with mRNA stability and cell-cell interaction in cancer biology. Here, HuR knockdown inhibited bone metastasis and osteolysis of metastatic
Aya Yanagawa-Matsuda et al.
Oncology reports, 41(2), 954-960 (2018-11-16)
AU-rich elements (AREs) are RNA elements that enhance the rapid decay of mRNA. The fate of ARE-mRNA is controlled by ARE-binding proteins. HuR, a member of the embryonic lethal abnormal vision (ELAV) family of RNA-binding proteins, is involved in the

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej