Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU060231

Sigma-Aldrich

MISSION® esiRNA

targeting human FAS

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCCAAGTTGCTGAATCAATGGAGCCCTCCCCAACCCGGGCGTTCCCCAGCGAGGCTTCCTTCCCATCCTCCTGACCACCGGGGCTTTTCGTGAGCTCGTCTCTGATCTCGCGCAAGAGTGACACACAGGTGTTCAAAGACGCTTCTGGGGAGTGAGGGAAGCGGTTTACGAGTGACTTGGCTGGAGCCTCAGGGGCGGGCACTGGCACGGAACACACCCTGAGGCCAGCCCTGGCTGCCCAGGCGGAGCTGCCTCTTCTCCCGCGGGTTGGTGGACCCGCTCAGTACGGAGTTGGGGAAGCTCTTTCACTTCGGAGGATTGCTCAACAACCATGCTGGGCATCTGGACCCTCCTACCTCTGGTTCTTACGTCTGTTGCTAGATTATCGTCCAAAAGTGTTAATGCCCAAGTGACTGACATCAACTCCAAGGGATTGGAATTGAGGAAGACTGTTACTACAGTTGAGACTCAGAACTTGGAAGGCCTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000026103

numer dostępu NCBI

NM_000043

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FAS(355) , FAS(355)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Neetu Singh et al.
European journal of pharmacology, 815, 462-469 (2017-10-05)
Endothelial dysfunction plays an important role in structural remodeling occurring in the pulmonary vasculature during pulmonary hypertension (PH). Endothelial injury causes apoptosis and activation of endothelial cells. However, some endothelial cells show apoptosis-resistance and later proliferate extensively leading to vascular
Chen-Ting Lee et al.
Radiation research, 188(2), 169-180 (2017-06-10)
Breast cancer is the most common malignancy diagnosed among women and represents a heterogeneous group of subtypes. Radiation therapy is a critical component of treatment for breast cancer patients. However, little is known about radiation response among these intrinsic subtypes.
Sara Cuadrado-Castano et al.
Molecular cancer therapeutics, 14(5), 1247-1258 (2015-03-13)
Newcastle disease virus (NDV) is considered a promising agent for cancer therapy due to its oncolytic properties. These include preferential replication in transformed cells, induction of innate and adaptive immune responses within tumors, and cytopathic effects in infected tumor cells
K Mizrahi et al.
Bone marrow transplantation, 49(7), 942-949 (2014-04-30)
The influence of TNF-α and Fas-ligand (FasL) on viability and function was evaluated in fresh- and expanded-umbilical cord blood (UCB) cells. CD34(+) progenitors and T cells display outstanding survival, whereas ~30% and >50% B lymphocytes and myeloid cells undergo spontaneous
Janet K Horton et al.
Radiation research, 184(5), 456-469 (2015-10-22)
Although a standardized approach to radiotherapy has been used to treat breast cancer, regardless of subtype (e.g., luminal, basal), recent clinical data suggest that radiation response may vary significantly among subtypes. We hypothesized that this clinical variability may be due

Produkty

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej