Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU058011

Sigma-Aldrich

MISSION® esiRNA

targeting human DPP4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TATCCAAAGGCAGGAGCTGTGAATCCAACTGTAAAGTTCTTTGTTGTAAATACAGACTCTCTCAGCTCAGTCACCAATGCAACTTCCATACAAATCACTGCTCCTGCTTCTATGTTGATAGGGGATCACTACTTGTGTGATGTGACATGGGCAACACAAGAAAGAATTTCTTTGCAGTGGCTCAGGAGGATTCAGAACTATTCGGTCATGGATATTTGTGACTATGATGAATCCAGTGGAAGATGGAACTGCTTAGTGGCACGGCAACACATTGAAATGAGTACTACTGGCTGGGTTGGAAGATTTAGGCCTTCAGAACCTCATTTTACCCTTGATGGTAATAGCTTCTACAAGATCATCAGCAATGAAGAAGGTTACAGACACATTTGCTATTTCCAAATAGATAAAAAAGACTGCACATTTATTACAAAAGGCACCTGGGAAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000197635

numer dostępu NCBI

NM_001935

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... DPP4(1803) , DPP4(1803)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Toshihiro Okamoto et al.
Biochemical and biophysical research communications, 504(2), 491-498 (2018-09-11)
Malignant pleural mesothelioma (MPM) is an aggressive malignancy arising from mesothelial lining of pleura. It is associated with a poor prognosis, partly due to the lack of a precise understanding of the molecular mechanisms associated with its malignant behavior. In
Ahmed A Al-Qahtani et al.
Oncotarget, 8(6), 9053-9066 (2017-01-25)
Middle East Respiratory Syndrome Corona Virus (MERS-CoV) is transmitted via the respiratory tract and causes severe Acute Respiratory Distress Syndrome by infecting lung epithelial cells and macrophages. Macrophages can readily recognize the virus and eliminate it. MERS-CoV infects cells via
Youichi Sato et al.
The Journal of endocrinology, 223(2), 133-142 (2014-08-15)
In a previous study, we demonstrated that dipeptidyl peptidase 4 (DPP4)-deficient rats were susceptible to reduced glomerular filtration rate as a result of streptozotocin (STZ)-induced diabetes. Therefore, we proposed that DPP4 might be responsible for the preservation of renal function.

Protokoły

Coronavirus qPCR Design Case Study & Related Products to Support SARS-CoV-2 Research

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej