Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU057281

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACCCTGGACCTCAAACTGTTAACCGAGGATTCAGAGAATCAAAGGTTAGCTTATGTTACATATCAAGATATTCGAAAAATTAGTGGCCTTAAAGACCAAACTGTTATAGTTGTGAAAGCCCCTCCAGAAACAAGACTTGAAGTGCCTGACTCAATAGAGAGCCTACAAATACATTTGGCAAGTACCCAAGGGCCCATTGAGGTTTACTTATGTCCAGAAGAGACTGAAACACACAGTCCAATGAAAACAAACAACCAAGACCACAATGGGAATATCCCTAAACCCGCTTCCAAAGACTTGGCTTCAACCAACTCAGGACATAGCGATTGCTCAGTTTCTATGGGAAACCTTTCTCCTCTGGCCTCCCCAGCCAACCTCTTACAGCAGACTGAGGACCAAATTCCTTCCAACCTAGAAGGACCGTTTGTGAACTTACTGCCTCCCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000112242

numer dostępu NCBI

NM_001949

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... E2F3(1871) , E2F3(1871)

Opis ogólny

3355 esiRNA to siRNA przygotowane z użyciem endorybonukleazy. Stanowią one heterogeniczną mieszaninę siRNA, które celują w tę samą sekwencję mRNA. Te wielokrotne wyzwalacze wyciszania prowadzą do wysoce specyficznego i skutecznego wyciszania genów.

Aby uzyskać dodatkowe informacje, a także wyświetlić wszystkie dostępne opcje esiRNA, odwiedź SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Zhicai Feng et al.
OncoTargets and therapy, 11, 5303-5313 (2018-09-15)
Melanoma is a malignant tumor that seriously affects patients. The pathogenesis of malignant melanoma is complex, and the cell cycle is closely related to tumor progression. Based on the catalog of cancer somatic mutations, we found that overexpression of the
Junsheng Guo et al.
International journal of clinical and experimental pathology, 13(3), 587-596 (2020-04-10)
Bladder cancer is a common, serious disease worldwide. MicroRNAs (miRNAs) have been reported to participate in the development and progression in many cancers, including bladder cancer. However, the exact roles of miR-22 in bladder cancer process and its underlying mechanism
Satoko Nakashima et al.
European journal of dermatology : EJD, 27(5), 464-471 (2017-07-26)
Although angiosarcoma exhibits aggressive progression and is associated with unfavourable prognosis, its pathogenesis is poorly understood. In the present study, we investigated the possibility that microRNAs play a role in the pathogenesis of angiosarcoma. microRNA expression was evaluated by array
Sivakumar Vadivel Gnanasundram et al.
Nature communications, 8(1), 2103-2103 (2017-12-14)
The c-myc oncogene stimulates ribosomal biogenesis and protein synthesis to promote cellular growth. However, the pathway by which cells sense and restore dysfunctional mRNA translation and how this is linked to cell proliferation and growth is not known. We here
Dianzhong Geng et al.
International journal of gynecological cancer : official journal of the International Gynecological Cancer Society, 25(4), 707-713 (2015-02-13)
Previous studies confirmed that high-risk human papillomavirus (HR-HPV) infection is a risk factor of cervical cancer, and the infection was associated with significantly reduced miR-34a expression during carcinogenesis. However, the downstream targets of miR-34a and their roles are still not
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej