Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU050311

Sigma-Aldrich

MISSION® esiRNA

targeting human PTGS2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCGGGAACACAACAGAGTATGCGATGTGCTTAAACAGGAGCATCCTGAATGGGGTGATGAGCAGTTGTTCCAGACAAGCAGGCTAATACTGATAGGAGAGACTATTAAGATTGTGATTGAAGATTATGTGCAACACTTGAGTGGCTATCACTTCAAACTGAAATTTGACCCAGAACTACTTTTCAACAAACAATTCCAGTACCAAAATCGTATTGCTGCTGAATTTAACACCCTCTATCACTGGCATCCCCTTCTGCCTGACACCTTTCAAATTCATGACCAGAAATACAACTATCAACAGTTTATCTACAACAACTCTATATTGCTGGAACATGGAATTACCCAGTTTGTTGAATCATTCACCAGGCAAATTGCTGGCAGGGTTGCTGGTGGTAGGAATG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000073756

numer dostępu NCBI

NM_000963

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PTGS2(5743) , PTGS2(5743)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Mia Madel Alfajaro et al.
PloS one, 13(7), e0200726-e0200726 (2018-07-19)
Cyclooxygenases (COXs)/prostaglandin E2 (PGE2) signaling pathways are known to modulate a variety of homeostatic processes and are involved in various pathophysiological conditions. COXs/PGE2 signaling pathways have also been demonstrated to have proviral or antiviral effects, which appeared different even in
Denise Philipp et al.
Stem cell research & therapy, 9(1), 286-286 (2018-10-26)
During the last decade, mesenchymal stem cells (MSCs) have gained much attention in the field of regenerative medicine due to their capacity to differentiate into different cell types and to promote immunosuppressive effects. However, the underlying mechanism of MSC-mediated immunoregulation
Bing-Wei Dong et al.
Biochemical and biophysical research communications, 503(4), 2293-2300 (2018-07-03)
Cisplatin (CDDP)-based systematic chemotherapy remains the mainstay of treatment for muscle-invasive bladder cancer (MIBC). However, acquired resistance to CDDP, a multifactorial process governed by an array of signals acting at different levels, is the major problem in BC treatment. Here
Lei Zhang et al.
Reproduction, fertility, and development (2018-07-10)
Circular RNAs (circRNAs) have been found to play important functional roles in epigenetic regulation under certain physiological and pathological conditions. However, knowledge of circRNAs during the development of receptive endometrium (RE) from pre-RE is limited. In the RE of dairy
Bing-Bing Lei et al.
Journal of molecular neuroscience : MN, 67(2), 173-180 (2018-11-25)
The cold-inducible protein RBM3 mediates hypothermic neuroprotection against nitric oxide (NO)-induced cell death. Meanwhile, it is well-known that cyclooxygenase-2 (COX-2) is upregulated by RBM3 in several types of cells; however, it is still unclear whether COX-2 contributes to the neuroprotective
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej