Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU050181

Sigma-Aldrich

MISSION® esiRNA

targeting human LRG1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CCATCTCCTGTCAACCACCTGCCGAAATCCCCGGCTACCTGCCAGCCGACACCGTGCACCTGGCCGTGGAATTCTTCAACCTGACCCACCTGCCAGCCAACCTCCTCCAGGGCGCCTCTAAGCTCCAAGAATTGCACCTCTCCAGCAATGGGCTGGAAAGCCTCTCGCCCGAATTCCTGCGGCCAGTGCCGCAGCTGAGGGTGCTGGATCTAACCCGAAACGCCCTGACCGGGCTGCCCCCGGGCCTCTTCCAGGCCTCAGCCACCCTGGACACCCTGGTATTGAAAGAAAACCAGCTGGAGGTCCTGGAGGTCTCGTGGCTACACGGCCTGAAAGCTCTGGGGCATCTGGACCTGTCTGGGAACCGCCTCCGGAAACTGCCCCCCGGGCTGCTGGCCAACTTCACCCTCCTGCGCACCCTTGACCTTGGGGAGAACCAGTTGGAGACCTTGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000171236

numer dostępu NCBI

NM_052972

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... LRG1(116844) , LRG1(116844)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
QCS
DOR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yiyun Wang et al.
Cell death & disease, 8(3), e2715-e2715 (2017-03-31)
The incomplete understanding of aberrant neovascularization, which contributes to osteoarthritis suggests that additional modulators have yet to be identified. Our objective was to identify the role of Leucine-rich-alpha-2-glycoprotein1 (LRG1), a new regulator of pathogenic angiogenesis, in osteoarthritis progression and to
Lan Luan et al.
Experimental and therapeutic medicine, 21(4), 367-367 (2021-03-19)
Retinoblastoma (RB) is the most common primary intraocular cancer type that occurs during retinal development in childhood. Previous studies have reported that long non-coding RNAs (lncRNAs) are involved in the development of RB. Therefore, the aim of the present study
Qian Zhang et al.
OncoTargets and therapy, 11, 2745-2752 (2018-05-23)
Leucine-rich α-2-glycoprotein-1 (LRG1) is differentially expressed in many kinds of diseases including cancer, however, it has not been thoroughly studied yet. The objective of this study was to detect the expression and potential mechanism of LRG1 in colorectal cancer (CRC).
Masaaki Yamamoto et al.
Cancer science, 108(10), 2052-2060 (2017-07-27)
Gastric cancer is one of the most common malignant tumors. Although improvement in chemotherapy has been achieved, the clinical prognosis of advanced gastric cancer remains poor. Therefore, it is increasingly important to predict the prognosis and determine whether patients should
Gu Gong et al.
Journal of molecular neuroscience : MN, 54(1), 20-26 (2014-02-15)
Lipopolysaccharide (LPS) preconditioning is a powerful neuroprotective phenomenon by which an injurious stimulus renders the brain resistant to a subsequent damaging ischemic insult. The LPS response gene (Lrg) is a recently identified gene in human dental pulp cells treated with
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej