Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU048411

Sigma-Aldrich

MISSION® esiRNA

targeting human WRN

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACCCACGGAGGGTTTCTATCTTACTAAAGGATATTTCAGAAAATCTATATTCACTGAGGAGGATGATAATTGGGTCTACTAACATTGAGACTGAACTGAGGCCCAGCAATAATTTAAACTTATTATCCTTTGAAGATTCAACTACTGGGGGAGTACAACAGAAACAAATTAGAGAACATGAAGTTTTAATTCACGTTGAAGATGAAACATGGGACCCAACACTTGATCATTTAGCTAAACATGATGGAGAAGATGTACTTGGAAATAAAGTGGAACGAAAAGAAGATGGATTTGAAGATGGAGTAGAAGACAACAAATTGAAAGAGAATATGGAAAGAGCTTGTTTGATGTCGTTAGATATTACAGAACATGAACTCCAAATTTTGGAACAGCAGTCTCAGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000165392

numer dostępu NCBI

NM_000553

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... WRN(7486) , WRN(7486)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
NBV
QCS
KZT
PXT
EXT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jyotirindra Maity et al.
DNA repair, 68, 1-11 (2018-05-26)
Impaired autophagy may be associated with normal and pathological aging. Here we explore a link between autophagy and domain function of Werner protein (WRNp). Werner (WRN) mutant cell lines AG11395, AG05229 and normal aged fibroblast AG13129 display a deficient response
Alaina R Martinez et al.
Genes, chromosomes & cancer, 56(8), 617-631 (2017-04-12)
Cancer cells require telomere maintenance to enable uncontrolled growth. Most often telomerase is activated, although a subset of human cancers are telomerase-negative and depend on recombination-based mechanisms known as ALT (Alternative Lengthening of Telomeres). ALT depends on proteins that are
Edmond M Chan et al.
Nature, 568(7753), 551-556 (2019-04-12)
Synthetic lethality-an interaction between two genetic events through which the co-occurrence of these two genetic events leads to cell death, but each event alone does not-can be exploited for cancer therapeutics1. DNA repair processes represent attractive synthetic lethal targets, because
Luxi Sun et al.
Nucleic acids research, 45(7), 3844-3859 (2017-02-06)
Werner syndrome (WS) is a progeroid-like syndrome caused by WRN gene mutations. WS cells exhibit shorter telomere length compared to normal cells, but it is not fully understood how WRN deficiency leads directly to telomere dysfunction. By generating localized telomere-specific
Venkateswarlu Popuri et al.
Nucleic acids research, 42(9), 5671-5688 (2014-03-14)
A variety of human tumors employ alternative and recombination-mediated lengthening for telomere maintenance (ALT). Human RecQ helicases, such as BLM and WRN, can efficiently unwind alternate/secondary structures during telomere replication and/or recombination. Here, we report a novel role for RECQL1
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej