Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU046501

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGGAGCTGGAACAAATGAAAAAGTACTGACAGAAATTATTGCTTCAAGGACACCTGAAGAACTGAGAGCCATCAAACAAGTTTATGAAGAAGAATATGGCTCAAGCCTGGAAGATGACGTGGTGGGGGACACTTCAGGGTACTACCAGCGGATGTTGGTGGTTCTCCTTCAGGCTAACAGAGACCCTGATGCTGGAATTGATGAAGCTCAAGTTGAACAAGATGCTCAGGCTTTATTTCAGGCTGGAGAACTTAAATGGGGGACAGATGAAGAAAAGTTTATCACCATCTTTGGAACACGAAGTGTGTCTCATTTGAGAAAGGTGTTTGACAAGTACATGACTATATCAGGATTTCAAATTGAGGAAACCATTGACCGCGAGACTTCTGGCAATTTAGAGCAACTACTCCTTGCTGTTGTGAAATCTATTCGAAGTATACCTGCCTACCTTGCAGAGA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xujuan Sun et al.
Cell death & disease, 9(6), 637-637 (2018-05-29)
As a calcium-dependent phospholipid binding annexin protein, annexin A5 (Anxa5) links to the progression, metastasis, survival, and prognosis of a variety of cancers. Current work showed ANXA5 overexpression was positively correlated with the upregulations of CRKI/II and RAC1 in hepatocarcinoma
Nahee Park et al.
Journal of toxicology and environmental health. Part A, 77(22-24), 1467-1476 (2014-10-25)
Auranofin is a lipophilic gold compound with anti-inflammatory and immunosuppressive properties. This compound also exerts antiproliferative effects in several human cancer cell lines. Although auranofin induces apoptosis in human cancer cells, the underlying mechanisms remain unclear. This study investigated auranofin-mediated
Jian Zhou et al.
Respiratory research, 19(1), 96-96 (2018-05-23)
Epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors, including gefitinib, are first-line drugs against advanced non-small cell lung cancer with activating EGFR mutations. However, the development of resistance to such drugs is a major clinical challenge. The role of annexin
Jingjing Wang et al.
Oncology reports, 32(6), 2557-2563 (2014-10-18)
Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin's lymphoma worldwide. Although patient outcomes have significantly improved to a greater than 40% cure rate by the combinatorial cyclophosphamide, doxorubicin, vincristine and prednisone (CHOP) chemotherapy, which is widely

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej