Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU046081

Sigma-Aldrich

MISSION® esiRNA

targeting human FAT1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

AATTGCTGACAACGCCTCTCCGAAGTTTACATCAAAAGAATATTCTGTTGAACTTAGTGAAACTGTCAGCATTGGGAGTTTCGTTGGGATGGTTACAGCCCATAGTCAATCATCAGTGGTGTATGAAATAAAAGATGGAAATACAGGTGATGCTTTTGATATTAATCCACATTCTGGAACTATCATCACTCAGAAAGCCCTGGACTTTGAAACTTTGCCCATTTACACATTGATAATACAAGGAACTAACATGGCTGGTTTGTCCACTAATACAACGGTTCTAGTTCACTTGCAGGATGAGAATGACAACGCGCCAGTTTTTATGCAGGCAGAATATACAGGACTCATTAGTGAATCAGCCTCAATTAACAGCGTGGTCCTAACAGACAGGAATGTCCCACTGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000083857

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FAT1(2195) , FAT1(2195)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
QCS

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xinhui Wu et al.
Cell biology international, 41(1), 24-32 (2016-10-21)
Porcine cumulus cells are localized around oocytes and act as a specific type of granulosa that plays essential roles in the development and maturation of oocytes, the development and atresia of follicles, and the development of embryos. Studies of FAT1
Evanka Madan et al.
International journal of cancer, 139(11), 2570-2582 (2016-08-19)
The hypoxic microenvironment is an important contributor of glioblastoma (GBM) aggressiveness via HIF1α, while tumour inflammation is profoundly influenced by FAT Atypical Cadherin (FAT1). This study was designed to explore the functional interaction and significance of FAT1 and HIF1α under
Andrey Sheyko et al.
Nature, 539(7630), 551-554 (2016-11-08)
A striking feature of many natural dynamos is their ability to undergo polarity reversals. The best documented example is Earth's magnetic field, which has reversed hundreds of times during its history. The origin of geomagnetic polarity reversals lies in a
Tung-Nien Hsu et al.
Cancers, 11(12) (2019-12-01)
FAT atypical cadherin 1 (FAT1) regulates cell-cell adhesion and extracellular matrix architecture, while acting as tumor suppressor or oncogene, context-dependently. Despite implication of FAT1 in several malignancies, its role in oral squamous cell carcinoma (OSCC) remains unclear. Herein, we document
Longyue L Cao et al.
Nature, 539(7630), 575-578 (2016-11-10)
Mitochondrial products such as ATP, reactive oxygen species, and aspartate are key regulators of cellular metabolism and growth. Abnormal mitochondrial function compromises integrated growth-related processes such as development and tissue repair, as well as homeostatic mechanisms that counteract ageing and

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej