Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU044171

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCGCTTCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000100030

numer dostępu NCBI

NM_002745

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MAPK1(5594) , MAPK1(5594)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jian Zhang et al.
Experimental & molecular medicine, 49(9), e379-e379 (2017-09-25)
The objective of this study was to investigate the regulatory effects of TGF-β1 on CCL3/4 expression and inflammation-related pain during intervertebral disc degeneration (IVDD). TGF-β1 and CCL3/4 expression patterns in different degenerative human nucleus pulposus (NP) tissues were measured by
Li-Li Xu et al.
Oxidative medicine and cellular longevity, 2018, 3271617-3271617 (2018-06-12)
Ulcerative colitis (UC) is a common inflammatory bowel disease that can destroy the integrity of the colon and increase the risk of colorectal cancer. Oxidative stress is one of the critical pathogenic factors for UC, further impairing the entire affected
Susanne Ulm et al.
Journal of molecular and cellular cardiology, 72, 104-116 (2014-03-19)
Mitogen-activated protein kinases (MAPKs) are involved in the regulation of cardiac hypertrophy and myocyte survival. Extracellular signal regulated protein kinase 1 and 2 (ERK1/2) are key components in the MAPK signaling pathways. Dysfunction of ERK1/2 in congenital heart diseases (Noonan
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Vijay G Ramakrishnan et al.
Haematologica, 104(10), 2061-2074 (2019-03-09)
Despite recent advances in the treatment of multiple myeloma, patients with this disease still inevitably relapse and become refractory to existing therapies. Mutations in K-RAS, N-RAS and B-RAF are common in multiple myeloma, affecting 50% of patients at diagnosis and
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej