Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU043401

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGTGGATGTGGATGTGTCCTCTGGCTTTATTTATTGGTGTGATTTTAGCAGCTCAGTGGCATCTGATAATGCGATCCGTAGAATTAAACCAGATGGATCTTCTCTGATGAACATTGTGACACATGGAATAGGAGAAAATGGAGTCCGGGGTATTGCAGTGGATTGGGTAGCAGGAAATCTTTATTTCACCAATGCCTTTGTTTCTGAAACACTGATAGAAGTTCTGCGGATCAATACTACTTACCGCCGTGTTCTTCTTAAAGTCACAGTGGACATGCCTAGGCATATTGTTGTAGATCCCAAGAACAGATACCTCTTCTGGGCTGACTATGGGCAGAGACCAAAGATTGAGCGTTCTTTCCTTGACTGTACCAATCGAACAGTGCTTGTGTCAGAGGGCATTGTC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000081479

numer dostępu NCBI

NM_004525

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... LRP2(4036) , LRP2(4036)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuan Gao et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(6), 7684-7693 (2019-03-21)
Osteoblast differentiation of human mesenchymal stem cells (hMSCs) is stimulated by 1α,25-dihydroxycholecalciferol [1α,25(OH)2D3] and 25-hydroxycholecalciferol [25(OH)D3]; the latter's effects require intracellular hydroxylation to 1α,25(OH)2D3. Thus, hMSCs are both a source of and target for 1α,25(OH)2D3. Megalin is a transmembrane receptor
Rohit Upadhyay et al.
JCI insight, 5(14) (2020-06-17)
Free light chains (FLCs) induce inflammatory pathways in proximal tubule cells (PTCs). The role of TLRs in these responses is unknown. Here we present findings on the role of TLRs in FLC-induced PTC injury. We exposed human kidney PTC cultures
Aurélien Briens et al.
Cell discovery, 3, 17001-17001 (2017-04-19)
Plasminogen activation is involved in many processes within the central nervous system, including synaptic plasticity, neuroinflammation and neurodegeneration. However, the mechanisms that regulate plasminogen activation in the brain still remain unknown. Here we demonstrate that astrocytes participate in this regulation

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej