Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU043071

Sigma-Aldrich

MISSION® esiRNA

targeting human XRN1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GACATCCGAGCTTTCGACTCCCGTTTCTCCAATATCAAAACATTGGATGATTTGTTTCCTCTGAGAAGTATGGTCTTTATGCTGGGAACTCCCTATTATGGCTGCACTGGAGAAGTTCAGGATTCAGGTGATGTGATTACAGAAGGTAGGATTCGTGTGATTTTCAGCATTCCATGTGAACCCAATCTTGATGCTTTAATACAGAACCAGCATAAATATTCTATAAAGTACAACCCAGGATATGTGTTGGCCAGTCGCCTTGGAGTGAGTGGATACCTTGTTTCAAGGTTTACAGGAAGTATTTTTATTGGAAGAGGATCTAGGAGAAACCCTCATGGAGACCATAAAGCAAATGTGGGTTTAAATCTCAAATTCAACAAGAAAAATGAGGAGGTACCTGGATATACTAAGAAAGTTGGAAGTGAATGGATGTATTCATCTGCAGCAGAACAACTTCTGGCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000114127

numer dostępu NCBI

NM_019001

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... XRN1(54464) , XRN1(54464)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Joséphine Zangari et al.
Nucleic acids research, 45(7), 4131-4141 (2016-12-21)
Extracellular vesicles (EVs) have been shown to play an important role in intercellular communication as carriers of DNA, RNA and proteins. While the intercellular transfer of miRNA through EVs has been extensively studied, the stability of extracellular miRNA (ex-miRNA) once
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Shin-Ichiro Hori et al.
Biochemical and biophysical research communications, 464(2), 506-511 (2015-07-15)
Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood.
Oussama Meziane et al.
Scientific reports, 5, 16688-16688 (2015-11-21)
The decapping scavenger enzyme DcpS is known for its role in hydrolyzing the cap structure following mRNA degradation. Recently, we discovered a new function in miRNA degradation activation for the ortholog of DcpS in C. elegans. Here we show that

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej