Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU041301

Sigma-Aldrich

MISSION® esiRNA

targeting human CD9

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCAAGAAACTAATAATAATAATTCCAGCTTCTACACAGGAGTCTATATTCTGATCGGAGCCGGCGCCCTCATGATGCTGGTGGGCTTCCTGGGCTGCTGCGGGGCTGTGCAGGAGTCCCAGTGCATGCTGGGACTGTTCTTCGGCTTCCTCTTGGTGATATTCGCCATTGAAATAGCTGCGGCCATCTGGGGATATTCCCACAAGGATGAGGTGATTAAGGAAGTCCAGGAGTTTTACAAGGACACCTACAACAAGCTGAAAACCAAGGATGAGCCCCAGCGGGAAACGCTGAAAGCCATCCACTATGCGTTGAACTGCTGTGGTTTGGCTGGGGGCGTGGAACAGTTTATCTCAGACATCTGCCCCAAGAAGGACGTACTCGAAACCTTCACCGTGAAGTCCTGTCCTGATGCCATC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000010278

numer dostępu NCBI

NM_001769

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CD9(928) , CD9(928)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Joshua S Brzozowski et al.
Scientific reports, 8(1), 8822-8822 (2018-06-13)
To facilitate intercellular communication, cells release nano-sized, extracellular vesicles (EVs) to transfer biological cargo to both local and distant sites. EVs are enriched in tetraspanins, two of which (CD9 and CD151) have altered expression patterns in many solid tumours, including
Yuichiro Miki et al.
British journal of cancer, 118(6), 867-877 (2018-02-14)
This corrects the article DOI: 10.1038/bjc.2017.85.
Jung Hee Cho et al.
Cell death and differentiation, 27(9), 2681-2696 (2020-04-30)
CD9, a 24 kDa tetraspanin membrane protein, is known to regulate cell adhesion and migration, cancer progression and metastasis, immune and allergic responses, and viral infection. CD9 is upregulated in senescent endothelial cells, neointima hyperplasia, and atherosclerotic plaques. However, its role
Soonyean Hwang et al.
Cellular and molecular life sciences : CMLS, 76(8), 1595-1604 (2019-02-20)
Tetraspanin protein CD151 has typically been studied as binding partner and functional regulator of laminin-binding integrins. However, we show here that CD151 supports anti-cancer drug resistance independent of integrins. CD151 ablation sensitized multiple tumor cell types to several anti-cancer drugs
Michael J Herr et al.
PloS one, 9(9), e106999-e106999 (2014-09-04)
The most prevalent cardiovascular diseases arise from alterations in vascular smooth muscle cell (VSMC) morphology and function. Tetraspanin CD9 has been previously implicated in regulating vascular pathologies; however, insight into how CD9 may regulate adverse VSMC phenotypes has not been
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej