Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU039391

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3CA

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000121879

numer dostępu NCBI

NM_006218

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PIK3CA(5290) , PIK3CA(5290)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiuling Liang et al.
Yonsei medical journal, 60(2), 182-190 (2019-01-23)
This study aimed to investigate the effects of PIK3CA on the sensitivity of acute B lymphocytic leukemia cells (Nalm-6 cells) to chemotherapy drugs. Children's normal B lymphocytes and Nalm-6 cells were cultured. Nalm-6 cells were transfected with PIK3CA siRNA (siPIK3CA
Shuke Ge et al.
Oncology research, 25(8), 1363-1371 (2017-03-02)
miR-152, as a tumor suppressor, has been reported to be downregulated in a number of cancer cell lines and tumor tissues, including breast cancer. This study aimed to investigate the role of miR-152 in human breast cancer and its underlying
Zhao Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2505-2515 (2017-11-14)
Numerous studies have demonstrated that aberrant microRNA (miRNA) expression is involved in human disease including cancer. To date, the potential miRNAs regulating lung cancer growth and progression are not fully identified yet. In this study, the expression of miR-142-5p was
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej