Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU037081

Sigma-Aldrich

MISSION® esiRNA

targeting human HAVCR2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTGGAGGAGCCCAATGAGTATTATTGCTATGTCAGCAGCAGGCAGCAACCCTCACAACCTTTGGGTTGTCGCTTTGCAATGCCATAGATCCAACCACCTTATTTTTGAGCTTGGTGTTTTGTCTTTTTCAGAAACTATGAGCTGTGTCACCTGACTGGTTTTGGAGGTTCTGTCCACTGCTATGGAGCAGAGTTTTCCCATTTTCAGAAGATAATGACTCACATGGGAATTGAACTGGGACCTGCACTGAACTTAAACAGGCATGTCATTGCCTCTGTATTTAAGCCAACAGAGTTACCCAACCCAGAGACTGTTAATCATGGATGTTAGAGCTCAAACGGGCTTTTATATACACTAGGAATTCTTGACGTGGGGTCTCTGGAGCTCCAGGAAATTCGGGCACATCATA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Cecilia Fernandez-Ponce et al.
PloS one, 9(1), e85191-e85191 (2014-01-28)
Adaptive T cell responses are critical for controlling HCV infection. While there is clinical evidence of a relevant role for regulatory T cells in chronic HCV-infected patients, based on their increased number and function; mechanisms underlying such a phenomena are
Huapeng Lin et al.
Oncology letters, 14(5), 5899-5905 (2017-11-09)
T-cell immunoglobulin mucin (TIM)-3 is an important member of the TIM gene family, which was thought to contribute to the progression of numerous types of cancer, including hepatocellular carcinoma (HCC); however, the mechanism underlying TIM-3 functions in HCC progression has
Rong-Ti Ge et al.
Immunologic research, 64(2), 470-475 (2015-09-26)
The T helper 1 (Th1) polarization plays a critical role in the pathogenesis of a number of inflammatory disorders in the body; the remedies in the correction of polarized Th1 cells are limited. This study aims to investigate the role
Yong-Rui Piao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(11), 11409-11414 (2014-08-15)
T cell immunoglobulin domain and mucin domain-containing molecule 3 (Tim-3) is a newly discovered immunomodulatory, which plays an important role in immunity regulation. Recent evidence suggests that Tim-3 is differentially regulated in a variety of tumors and has a potential
Xiao-Wen Li et al.
Asian Pacific journal of tropical medicine, 8(11), 937-943 (2015-11-29)
To discuss the expression of mitogen-activated protein kinase 1 (MAPK1) in the cervical cancer and effect of MAPK1 gene silencing on epithelial-mesenchymal transition and invasion and metastasis. Immunohistochemistry, western blot and RT-PCR method were employed to detect the expression of

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej