Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU035131

Sigma-Aldrich

MISSION® esiRNA

targeting human KLF5

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCACCTGAGAACTGGCCTCTACAAATCCCAGAGACCGTGCGTAACACACATCAAGACAGAACCTGTTGCCATTTTCAGCCACCAGAGTGAAACGACTGCCCCTCCTCCGGCCCCGACCCAGGCCCTCCCTGAGTTCACCAGTATATTCAGCTCACACCAGACCGCAGCTCCAGAGGTGAACAATATTTTCATCAAACAAGAACTTCCTACACCAGATCTTCATCTTTCTGTCCCTACCCAGCAGGGCCACCTGTACCAGCTACTGAATACACCGGATCTAGATATGCCCAGTTCTACAAATCAGACAGCAGCAATGGACACTCTTAATGTTTCTATGTCAGCTGCCATGGCAGGCCTTAACACACACACCTCTGCTGTTCCGCAGACTGCAGTGAAACAATTCCAGGGCAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000102554

numer dostępu NCBI

NM_001730

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... KLF5(688) , KLF5(688)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

P Chen et al.
European review for medical and pharmacological sciences, 24(8), 4224-4231 (2020-05-07)
This study aims to investigate the expression characteristics of Krüppel-like factor 5 (KLF5) in gastric cancer (GC) and its potential correlation to pathological indexes in GC patients. Molecular mechanisms underlying the regulatory effect of KLF5 on GC progression are explored.
Kaixin Wangzhou et al.
Frontiers in physiology, 11, 606967-606967 (2021-02-20)
Human periodontal ligament cells (hPDLCs) play a vital role in cell regeneration and tissue repair with multi-directional differentiation potential. microRNAs (miRs) are implicated in the osteogenesis of hPDLCs. This study explored the mechanism of miR-143-3p in osteogenesis of hPDLCs. Osteogenic
Yubo Liu et al.
Nature communications, 11(1), 5898-5898 (2020-11-21)
O-GlcNAc modification plays critical roles in regulating the stress response program and cellular homeostasis. However, systematic and multi-omics studies on the O-GlcNAc regulated mechanism have been limited. Here, comprehensive data are obtained by a chemical reporter-based method to survey O-GlcNAc
Yan-Yi Jiang et al.
Gastroenterology, 159(4), 1311-1327 (2020-07-04)
We investigated the transcriptome of esophageal squamous cell carcinoma (ESCC) cells, activity of gene regulatory (enhancer and promoter regions), and the effects of blocking epigenetic regulatory proteins. We performed chromatin immunoprecipitation sequencing with antibodies against H3K4me1, H3K4me3, and H3K27ac and
Xiaolong Wei et al.
Oncotarget, 8(65), 109301-109318 (2018-01-10)
Achaete scute-like 2 (Ascl2) is the Wnt signaling target, its regulation by other signaling is undefined. Now we demonstrated that CD133+/CD44+ cell population from HT-29 or Caco-2 cells exhibited cancer stem cell (CSC) properties with highly expressed Ascl2, which is

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej