Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU032271

Sigma-Aldrich

MISSION® esiRNA

targeting human IKBKG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACTCCCTGTGAAGCTCTCCAGCATCATCGAGGTCCCATCAGGTGGGGAAAGATGCTGTTCCAGGCGCACACTAGTCTACAAGGCCAGAGCTTTCTGGAAGGGGGCACCCTTGCCCTGTTGGATGAATAGGCACCTCTGGAAGAGCCAACTGTGTGAGATGGTGCAGCCCAGTGGTGGCCCGGCAGCAGATCAGGACGTACTGGGCGAAGAGTCTCCTCTGGGGAAGCCAGCCATGCTGCACCTGCCTTCAGAACAGGGCGCTCCTGAGACCCTCCAGCGCTGCCTGGAGGAGAATCAAGAGCTCCGAGATGCCATCCGGCAGAGCAACCAGATTCTGCGGGAGCGCTGCGAGGAGCTTCTGCATTTCCAAGCCAGCCAGAGGGAGGAGAAGGAGTTCCTCATGTGCAAGTTCCAGGAGGCCAGGAAACTGGTGGAGAGACTCGGCCTGGAGAAGCTCGATCTGAAGAGGCAGAAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000073009

numer dostępu NCBI

NM_003639

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IKBKG(8517) , IKBKG(8517)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
NRR
MPR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jérôme Bouchet et al.
Journal of immunology (Baltimore, Md. : 1950), 198(7), 2967-2978 (2017-02-27)
The role of endosomes in receptor signal transduction is a long-standing question, which remains largely unanswered. The T cell Ag receptor and various components of its proximal signaling machinery are associated with distinct endosomal compartments, but how endosomal traffic affects
Sona Hubackova et al.
Aging, 4(12), 932-951 (2013-02-07)
Many cancers arise at sites of infection and inflammation. Cellular senescence, a permanent state of cell cycle arrest that provides a barrier against tumorigenesis, is accompanied by elevated proinflammatory cytokines such as IL1, IL6, IL8 and TNFα. Here we demonstrate
Verena Quennet et al.
Nucleic acids research, 39(6), 2144-2152 (2010-11-20)
Topoisomerases class II (topoII) cleave and re-ligate the DNA double helix to allow the passage of an intact DNA strand through it. Chemotherapeutic drugs such as etoposide target topoII, interfere with the normal enzymatic cleavage/re-ligation reaction and create a DNA
Yu Gang Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5018-5033 (2019-01-01)
Cathepsin C (CtsC) functions as a central coordinator for activation of many serine proteases in immune cells. However, CtsC expression in gastric epithelial cells and its role in Helicobacter pylori infection remain unclear. Real-time PCR, Western blot, and immunohistochemistry analyses
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej