Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU029161

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIM32

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGGCTGACAGTAGTCGCAAGGAAATTCTCCATTTTCCTAAGGGTGGGGGCTATAGTGTCCTTATTCGAGAGGGACTTACCTGTCCGGTGGGCATAGCCCTAACTCCTAAGGGGCAGCTGCTGGTCTTGGACTGTTGGGATCATTGCATCAAGATCTACAGCTACCATCTGAGAAGATATTCCACCCCATAGGGGATGAGAAATTATCAGTTTCTTCTGCTCCCAAGCCAACTTCCCTTCCCTTAGTTCTTGGTTGTTAGTGGCACATGCAGAATAGACTCAGCCTATGTCCTGATTCCAGCTGGGTAGTTCTAGAACTTCAGAAGCTCCATCTTTTAATGTTTTTATTTGTTATGTCCCCCTCCCCGCTTCCCACCTAAATTTAGAGCTTTAAAAGATGCACTGCCCAAATAGGAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000119401

numer dostępu NCBI

NM_012210

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TRIM32(22954) , TRIM32(22954)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hao Cui et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 801-811 (2017-09-28)
Epithelial cells play important roles as a critical barrier in protecting the cornea from microbial pathogens infection. In this study, we were aiming to investigate the role of E3 ubiquitin ligase tripartite motif protein 32 (TRIM32) in corneal epithelial cells
Sarah Gilbertson et al.
eLife, 7 (2018-10-04)
Alterations in global mRNA decay broadly impact multiple stages of gene expression, although signals that connect these processes are incompletely defined. Here, we used tandem mass tag labeling coupled with mass spectrometry to reveal that changing the mRNA decay landscape
Maria Angeliki S Pavlou et al.
Molecular neurobiology, 54(6), 4257-4270 (2016-06-25)
Alpha-synuclein is an abundant neuronal protein which has been associated with physiological processes like synaptic function, neurogenesis, and neuronal differentiation but also with pathological neurodegeneration. Indeed, alpha-synuclein (snca) is one of the major genes implicated in Parkinson's disease (PD). However
Hideki Izumi et al.
Cancer research, 74(19), 5620-5630 (2014-08-08)
Asymmetric cell division (ACD) is a physiologic process during development and tissue homeostasis. ACD produces two unequal daughter cells: one has stem/progenitor cell activity and the other has potential for differentiation. Recent studies showed that misregulation of the balance between

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej