Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU028861

Sigma-Aldrich

MISSION® esiRNA

targeting human IGF1R

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGGATGCACCATCTTCAAGGGCAATTTGCTCATTAACATCCGACGGGGGAATAACATTGCTTCAGAGCTGGAGAACTTCATGGGGCTCATCGAGGTGGTGACGGGCTACGTGAAGATCCGCCATTCTCATGCCTTGGTCTCCTTGTCCTTCCTAAAAAACCTTCGCCTCATCCTAGGAGAGGAGCAGCTAGAAGGGAATTACTCCTTCTACGTCCTCGACAACCAGAACTTGCAGCAACTGTGGGACTGGGACCACCGCAACCTGACCATCAAAGCAGGGAAAATGTACTTTGCTTTCAATCCCAAATTATGTGTTTCCGAAATTTACCGCATGGAGGAAGTGACGGGGACTAAAGGGCGCCAAAGCAAAGGGGACATAAACACCAGGAACAACGGGGAGAGAGCCTCCTGTGAAAGTGACGTCCTGCATTTCACCTCCACCACCACGTCGAAGAATCGCATCATCATAACCTGGCACCGGTA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000140443

numer dostępu NCBI

NM_000875

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... IGF1R(3480) , IGF1R(3480)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Lu Chen et al.
OncoTargets and therapy, 12, 907-919 (2019-02-19)
A variety of microRNAs (miRNAs) are aberrantly expressed in acute myeloid leukemia (AML), and these dysregulated miRNAs perform crucial roles in tumorigenesis and progression of AML. miR-628-3p (miR-628), one of the miRNAs dysregulated in multiple types of human cancers, exerts
Bao-Feng Li et al.
Human cell, 30(4), 311-318 (2017-08-11)
In recent years, some studies have been made on the effects of circular RNA (circRNA) in osteoarthritis (OA) and so on; however, its mechanisms remain to be further explored. Studies have shown that tumor necrosis factor-alpha can inhibit hsa_circ_0045714 expression
Tomokazu Ohnuma et al.
Archives of biochemistry and biophysics, 635, 66-73 (2017-10-21)
Many lines of evidence demonstrate that transcription factor nuclear factor-E2-related factor 2 (Nrf2) plays essential roles in cancer cell proliferation and resistance to chemotherapy, thereby indicating that suppression of abnormal Nrf2 activation is needed for a new therapeutic approach. Our
Li-Li Mei et al.
Cancer biomarkers : section A of Disease markers, 20(4), 527-537 (2017-08-12)
miR-99a is down-regulated in esophageal squamous cell carcinoma (ESCC), however the role and underlying mechanism are still unknown. We aim to explore the role and mechanism of miR-99a down-regulation in ESCC. The expression of miR-99a in ESCC tissues and cell
Yann Neuzillet et al.
BMC cancer, 17(1), 636-636 (2017-09-09)
The insulin growth factor (IGF) pathway has been proposed as a potential therapeutic target in bladder cancer. We characterized the expression of components of the IGF pathway - insulin growth factor receptors (INSR, IGF1R, IGF2R), ligands (INS, IGF1, IGF2), and
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej