Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU028011

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC2A1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTTCACTGTCGTGTCGCTGTTTGTGGTGGAGCGAGCAGGCCGGCGGACCCTGCACCTCATAGGCCTCGCTGGCATGGCGGGTTGTGCCATACTCATGACCATCGCGCTAGCACTGCTGGAGCAGCTACCCTGGATGTCCTATCTGAGCATCGTGGCCATCTTTGGCTTTGTGGCCTTCTTTGAAGTGGGTCCTGGCCCCATCCCATGGTTCATCGTGGCTGAACTCTTCAGCCAGGGTCCACGTCCAGCTGCCATTGCCGTTGCAGGCTTCTCCAACTGGACCTCAAATTTCATTGTGGGCATGTGCTTCCAGTATGTGGAGCAACTGTGTGGTCCCTACGTCTTCATCATCTTCACTGTGCTCCTGGTTCTGTTCTTCATCTTCACCTACTTCAAAGTTCCTGAGACTAAAGGCCGGACCTTCGATGAGATCGCTTCCGGCTTCCGGCAGGGGGGAGCCAGCCAAAGTGACAAGACACCCGAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000117394

numer dostępu NCBI

NM_006516

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SLC2A1(6513) , SLC2A1(6513)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xiaohui Wei et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 54, 120-131 (2019-01-23)
Emerging hallmark of cancer is reprogrammed cellular metabolism, increased glycolytic metabolism is physiological characteristic of human malignant neoplasms. Saponin monomer 13 of the dwarf lilyturf tuber (DT-13) is the main steroidal saponin from Liriopes Radix, which has been reported to
Sarka Tumova et al.
Vascular pharmacology, 87, 219-229 (2016-11-09)
Endothelial cells are routinely exposed to elevated glucose concentrations post-prandially in healthy individuals and permanently in patients with metabolic syndrome and diabetes, and so we assessed their sugar transport capabilities in response to high glucose. In human umbilical vein (HUVEC)
Huanyu Zhao et al.
Journal of Cancer, 10(20), 4989-4997 (2019-10-11)
Background: Glucose transporter 1 (GLUT1) is the main factor of Warburg effect, which is associated with poor prognosis in many tumors. However, the underlying molecular mechanism of GLUT1 in the progression of non-small cell lung cancer (NSCLC) is unclear. Methods:
Hongshuo Zhang et al.
Frontiers in physiology, 11, 543148-543148 (2020-10-27)
Successful embryo implantation requires receptive endometrium, which is conducive to the process of embryo recognition, adhesion, and invasion within a certain period of time and is inseparable from the dynamic interaction between 17β-estradiol (E2) and progesterone (P4). Proper glucose metabolism
Zibo Zhao et al.
Science advances, 5(7), eaax0698-eaax0698 (2019-08-09)
The zinc finger of the cerebellum (ZIC) proteins has been implicated to function in normal tissue development. Recent studies have described the critical functions of Zic proteins in cancers and the potential tumor-suppressive functions in colon cancer development and progression.
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej