Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU024471

Sigma-Aldrich

MISSION® esiRNA

targeting human FADD

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGCTCGTCAGCTCAAAGTCTCAGACACCAAGATCGACAGCATCGAGGACAGATACCCCCGCAACCTGACAGAGCGTGTGCGGGAGTCACTGAGAATCTGGAAGAACACAGAGAAGGAGAACGCAACAGTGGCCCACCTGGTGGGGGCTCTCAGGTCCTGCCAGATGAACCTGGTGGCTGACCTGGTACAAGAGGTTCAGCAGGCCCGTGACCTCCAGAACAGGAGTGGGGCCATGTCCCCGATGTCATGGAACTCAGACGCATCTACCTCCGAAGCGTCCTGATGGGCCGCTGCTTTGCGCTGGTGGACCACAGGCATCTACACAGCCTGGACTTTGGTTCTCTCCAGGAAGGTAGCCCAGCACTGTGAAGACCCAGCAGGAAGCCAGGCTGAGTGAGCCACAGACCACCTGCTTCTGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000168040

numer dostępu NCBI

NM_003824

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FADD(8772) , FADD(8772)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Christiana G Savva et al.
BMC cancer, 16, 279-279 (2016-04-22)
Acquired resistance towards apoptosis is a hallmark of cancer. Elimination of cells bearing activated oncogenes or stimulation of tumor suppressor mediators may provide a selection pressure to overcome resistance. KC-53 is a novel biyouyanagin analogue known to elicit strong anti-inflammatory
Shih-Wei Wang et al.
Molecular carcinogenesis, 57(7), 866-877 (2018-03-23)
Luteolin (3',4',5,7-tetrahydroxyflavone), which exists in fruits, vegetables, and medicinal herbs, is used in Chinese traditional medicine for treating various diseases, such as hypertension, inflammatory disorders, and cancer. However, the gene-regulatory role of luteolin in cancer prevention and therapy has not
Zongliang Lu et al.
International journal of oncology, 56(2), 439-447 (2020-01-03)
Ophiopogonin D' (OPD') is a natural compound extracted from Ophiopogon japonicus, which is a plant used in traditional Chinese medicine. Our previous study has indicated that OPD' exhibits antitumor activity against androgen‑independent prostate cancer (PCa), but the effects and the
Fangfang Cai et al.
Cell death & disease, 11(1), 33-33 (2020-01-18)
Hydrogen sulfide (H2S) is now widely considered the third endogenous gasotransmitter and plays critical roles in cancer biological processes. In this study, we demonstrate that 5-(4-hydroxyphenyl)-3H-1,2-dithiole-3-thione (ADT-OH), the most widely used moiety for synthesising slow-releasing H2S donors, induces melanoma cell
Liang-Jun Wang et al.
Biochemical pharmacology, 162, 154-168 (2018-11-11)
Albendazole (ABZ) is a microtubule-targeting anthelmintic that acts against a variety of human cancer cells, but the dependence of its cytotoxicity on non-mitotic effect remains elusive. Thus, we aimed to explore the mechanistic pathway underlying the cytotoxicity of ABZ in
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej