Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU024031

Sigma-Aldrich

MISSION® esiRNA

targeting human SP3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTTTCCTGGTCAAACCCAAGTAGTTGCTAATGTGCCTCTTGGTCTGCCAGGAAATATTACGTTTGTACCAATCAATAGTGTCGATCTAGATTCTTTGGGACTCTCGGGCAGTTCTCAGACAATGACTGCAGGCATTAATGCCGACGGACATTTGATAAACACAGGACAAGCTATGGATAGTTCAGACAATTCAGAAAGGACTGGTGAGCGGGTTTCTCCTGATATTAATGAAACTAATACTGATACAGATTTATTTGTGCCAACATCCTCTTCATCACAGTTGCCTGTTACGATAGATAGTACAGGTATATTACAACAAAACACAAATAGCTTGACTACATCTAGTGGGCAGGTTCATTCTTCAGATCTTCAGGGAAATTATATCCAGTCGCCTGTTTCTGAAGAGACACAGGCACAGAATATTCAGGTTTCTACAGCACAGCCTGTTGTACAGCATCTACAACTTCAAGAGTCTCAGCAGCCAACCAGT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000172845

numer dostępu NCBI

NM_003111

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SP3(6670) , SP3(6670)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yan-Yan Xu et al.
Scientific reports, 7(1), 2090-2090 (2017-05-20)
Stimulator of Interferon Gene (STING) is a key mediator of innate immune signaling. STING plays a pivotal role in the pathogenesis of many diseases including infectious diseases, auto-immune diseases and cancer. Many studies have been carried out recently in the
Yinxian Wen et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12834-12846 (2020-08-09)
Maternal dexamethasone decreases the body length of the newborn. However, whether dexamethasone inhibits the development of the growth plate of the fetal long bone is still unknown. Here, we found that lengths of fetal femur and growth plate were both
Shawn T Beug et al.
Science signaling, 12(566) (2019-01-31)
The controlled production and downstream signaling of the inflammatory cytokine tumor necrosis factor-α (TNF-α) are important for immunity and its anticancer effects. Although chronic stimulation with TNF-α is detrimental to the health of the host in several autoimmune and inflammatory
Michael A Peplowski et al.
Journal of molecular medicine (Berlin, Germany), 96(10), 1081-1093 (2018-08-10)
Aquaporin (AQP) 3 expression is altered in inflammatory bowel diseases, although the exact mechanisms regulating AQP abundance are unclear. Although interferon gamma (IFNγ) is centrally involved in intestinal inflammation, the effect of this cytokine on AQP3 expression remains unknown. HT-29

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej