Przejdź do zawartości
Merck

EHU016621

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTGGCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTTTCCAGACTTTAGAGCTTGTGGCTTGAATGTTAAAGGTGTGACCACCGACA

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yanhui Yu et al.
DNA and cell biology, 36(3), 212-218 (2017-01-17)
Autophagy is a main defense strategy by which infected host cells can virtually induce the killing of parasite, including Toxoplasma gondii. However, the regulatory mechanisms of autophagy in T. gondii-infected nonhematopoietic cells are still unknown. Emerging evidence indicates that CCAAT/enhancer-binding
Hyun Lim et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 76, 153255-153255 (2020-06-20)
Prolonged exposure to the senescence-associated secretory phenotype (SASP) with age leads to chronic low-grade inflammation in neighboring cells and tissues, causing many chronic degenerative diseases. The effects on SASP production of the ethanol extract from Scutellaria radix and 17 isolated
Nirmalya Dasgupta et al.
Biochimica et biophysica acta, 1861(7), 1777-1787 (2017-03-28)
Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Hong Li et al.
Genetic testing and molecular biomarkers, 23(5), 304-309 (2019-04-11)
Aims: Metastasis is a significant obstacle to curing esophageal squamous cell carcinoma (ESCC). The CCAAT/enhancer binding protein β (C/EBPβ)

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej