Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU015561

Sigma-Aldrich

MISSION® esiRNA

targeting human PLAU

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGAGGTGGAAAACCTCATCCTACACAAGGACTACAGCGCTGACACGCTTGCTCACCACAACGACATTGCCTTGCTGAAGATCCGTTCCAAGGAGGGCAGGTGTGCGCAGCCATCCCGGACTATACAGACCATCTGCCTGCCCTCGATGTATAACGATCCCCAGTTTGGCACAAGCTGTGAGATCACTGGCTTTGGAAAAGAGAATTCTACCGACTATCTCTATCCGGAGCAGCTGAAAATGACTGTTGTGAAGCTGATTTCCCACCGGGAGTGTCAGCAGCCCCACTACTACGGCTCTGAAGTCACCACCAAAATGCTGTGTGCTGCTGACCCACAGTGGAAAACAGATTCCTGCCAGGGAGACTCAGGGGGACCCCTCGTCTGTTCCCTCCAAGGCCGCATGACTTTGACTGGAATTGTGAGCTGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000122861

numer dostępu NCBI

NM_002658

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PLAU(5328) , PLAU(5328)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
ASU
YQU
QCS
HDT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Peng Liu et al.
Scientific reports, 6, 37606-37606 (2016-11-22)
Pancreatic cancer is a highly metastatic and chemo-resistant disease. Secreted proteins involved in cell-cell interactions play an important role in changing the tumor microenvironment. Previous studies generally focus on the secretome of cancer cell line from serum-free media, due to
Anuradha Moirangthem et al.
Scientific reports, 6, 21903-21903 (2016-02-26)
In cancer progression, proteolytic enzymes like serine proteases and metalloproteinases degrade the basement membrane enabling the tumor cells to invade the adjacent tissues. Thus, invasion and metastasis are augmented by these enzymes. Simultaneous silencing of uPA and MMP9 in breast
Xin Zhao et al.
European journal of pharmacology, 880, 173225-173225 (2020-05-29)
Tripterygium wilfordii Hook F (TwHF) exhibits anti-tumor efficacy in pancreatic ductal adenocarcinoma (PDAC), however the pharmacological mechanisms are unclear due to complicated formulae and target genes. Using Traditional Chinese Medicine Systems Pharmacology and GeneCards databases, we performed a network pharmacology
Rishi K Jaiswal et al.
BioFactors (Oxford, England), 45(5), 803-817 (2019-07-19)
Telomerase is a specialized reverse transcriptase/terminal transferase enzyme that adds telomeric repeat sequences at the extreme end of a newly replicated chromosome. Apart from telomere lengthening, telomerase has many extracurricular activities. Telomerase is known to regulate the expression of many
Hai Li et al.
Integrative cancer therapies, 17(2), 511-523 (2017-06-20)
Gastric cancer (GC) is a malignancy with few effective treatment options after metastasis occurs. Quercetin (Qu) intake has been associated with reduced incidence and slow development of GC, probably due to its anti-proliferative and apoptotic effects, but it is unclear
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej