Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

Inne dokumenty

EHU014081

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM14

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATCAGAGTCGCAGCTTTCGTTCCGCCGCTCGCCGACAAAGTCCTCGCTGGATTACCGTCGCCTGCCCGATGCCCATTCCGATTACGCACGCTATTCGGGCTCCTATAATGATTACCTGCGGGCGGCTCAGATGCACTCTGGCTACCAGCGCCGCATGTAGGGCCATCCTGGGATGGGGCACCACAGGGAGGGAGGGAGAAAAGAGGTGGGTAGGGTTACAGATCCAGGTTATAACTACTCTGGCCCATACCTTTCCTGGTTGTGGTTTTTCATGCCCTCTACCATGTGGGCCTTCCCCAGGAGATGATCCTGTTAAGTGTTCGGCAGTAACCTACTTTGTTCCTTCGCCTCAGCAGCAAATCTTGCTACTGGCTCTAGATCTGCGGTTTCCCCTCTACCCTGCCTCCCGTCTCCCCAGAATGGGAATT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000173959

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... RBM14(10432) , RBM14(10432)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Song Gao et al.
International journal of oncology, 54(6), 1921-1932 (2019-05-14)
Osteosarcoma (OS) is a common primary malignancy in adolescents and children. MicroRNAs (miRNAs or miRs) can regulate the progression of OS. Herein, we explored the target genes and effects of miR‑9 in OS. Cell growth, colony formation and cell cycle
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej