Przejdź do zawartości
Merck

EHU010131

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGGACAGATCAGCACCAAATGCTAACCCAAGGAGCAGGTAATCGCAAGTTCAAATGCACAGAGTGTGGCAAGGCCTTCAAATATAAACACCATCTGAAAGAACACCTGCGAATTCACAGTGGTGAAAAACCTTACGAGTGCCCAAACTGCAAGAAACGTTTCTCCCATTCTGGTTCCTACAGTTCGCACATCAGCAGCAAGAAATGTATTGGTTTAATCTCTGTAAATGGCCGAATGAGAAACAATATCAAGACGGGTTCTTCCCCTAATTCTGTTTCTTCTTCTCCTACTAATTCAGCCATTACCCAGTTAAGAAACAAGTTGGAGAATGGAAAACCACTTAGTATGTCTGAACAGACAGGCTTACTTAAAATTAAAACAGAACCACTAGACTTCAATGACTATAAAGTTCTTATGGCTACACACGGGTTTAGTGGCACTAGTCCCTTTATGAATGGTGGGCTTGGAGCCACCAGCCCTTTAGGAGTTCATCCATCTGCTCAGAGTCCAATGCAGCACTTAGGTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Powiązane kategorie

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Loukia N Lili et al.
Cancer letters, 428, 184-191 (2018-05-08)
Expression levels of the miR-200 family of miRNAs are significantly reduced during the epithelial-to-mesenchymal transition (EMT) and consequent metastasis of ovarian and other cancers. Consistently, ectopic over-expression of miR-200 family miRNAs in mesenchymal-like cells reverses the process by converting treated
Tao Jiang et al.
Oncology reports, 38(1), 151-158 (2017-05-24)
This study was specifically designed to confirm the hypothesis that microRNA-200c (miR-200c) affects the development of cisplatin (DDP) resistance in human gastric cancer cells by targeting zinc finger E-box binding homeobox 2 (ZEB2). A total of 50 gastric cancer tissues and
D-M Geng et al.
European review for medical and pharmacological sciences, 21(8), 1746-1752 (2017-05-10)
To investigate the effect of ZEB2 silencing on cisplatin resistance in gastric cancer. The resulting cell line, SGC7901/DDP, was transfected with ZEB2 siRNA, non-specific siRNA, or vehicle control. The effectiveness of ZEB2 silencing was evaluated by reverse transcriptase-polymerase chain reaction
Steven Goossens et al.
Blood, 129(8), 981-990 (2017-01-11)
Elevated expression of the Zinc finger E-box binding homeobox transcription factor-2 (ZEB2) is correlated with poor prognosis and patient outcome in a variety of human cancer subtypes. Using a conditional gain-of-function mouse model, we recently demonstrated that ZEB2 is an
Sanchari Roy et al.
Clinical science (London, England : 1979), 130(14), 1197-1207 (2016-04-30)
miR-192-5p has gained increasing relevance in various diseases, however, its function in acute liver injury is currently unknown. We analysed miR-192-5p serum levels and hepatic miR-192-5p expression in mice after hepatic ischaemia and reperfusion (I/R) as well as in toxic

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej