Przejdź do zawartości
Merck

EHU009621

Sigma-Aldrich

MISSION® esiRNA

targeting human ERRFI1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACCAGCTGGCTCCTTTAACAAGCCAGCCATAAGGATATCCAACTGTTGTATACACAGAGCTTCTCCTAACTCCGATGAAGACAAACCTGAGGTTCCCCCCAGAGTTCCCATACCTCCTAGACCAGTAAAGCCAGATTATAGAAGATGGTCAGCAGAAGTTACTTCGAGCACCTATAGTGATGAAGACAGGCCTCCCAAAGTACCGCCAAGAGAACCTTTGTCACCGAGTAACTCGCGCACACCGAGTCCCAAAAGCCTTCCGTCTTACCTCAATGGGGTCATGCCCCCGACACAGAGCTTTGCCCCTGATCCCAAGTATGTCAGCAGCAAAGCACTGCAAAGACAGAACAGCGAAGGATCTGCCAGTAAGGTTCCTTGCATTCTGCCCATTATTGAAAATGGGAAGAAGGTTAGTTCAACACATTATTACCTACTACCTGAACGACCACCATACCTGGACAAATATGAAAAATTTTTTAGGGAAGCAGAAGAAACAAATGGAGGCGCCCAAATCCAGCCATTACCTGCTG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.

Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Da Hyun Kang et al.
BMC cancer, 20(1), 571-571 (2020-06-20)
The resistance of lung cancer to epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) is one of the unconquered frontiers in chemotherapy. Mitogen-inducible gene 6 (Mig-6) is known to inhibit the kinase activity of epidermal growth factor receptor (EGFR). Similarly, numerous
Soyoung Park et al.
Oncotarget, 7(8), 8916-8930 (2016-01-14)
Hexavalent Chromium [Cr(VI)] compounds are human lung carcinogens and environmental/occupational hazards. The molecular mechanisms of Cr(VI) carcinogenesis appear to be complex and are poorly defined. In this study, we investigated the potential role of Gene 33 (ERRFI1, Mig6), a multifunctional
Zixuan Li et al.
Experimental and molecular pathology, 102(3), 492-499 (2017-05-17)
The ablation of Mig-6 has been shown to induce tumor formation in various tissues. However, the relationships between Mig-6 expression, clinical pathological factors, and prognosis have not been clarified in hepatocellular carcinoma (HCC), and the mechanism by which Mig-6 regulates
Malgorzata Milewska et al.
PloS one, 10(6), e0129859-e0129859 (2015-06-13)
BRAF functions in the RAS-extracellular signal-regulated kinase (ERK) signaling cascade. Activation of this pathway is necessary to mediate the transforming potential of oncogenic BRAF, however, it may also cause a negative feedback that inhibits the epidermal growth factor receptor (EGFR).

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej