Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU003671

Sigma-Aldrich

MISSION® esiRNA

targeting human FUT4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CGTACCTGCTTTTCCTCGACCGCAACCCCGCGGTCTATCGCCGCTACTTCCACTGGCGCCGGAGCTACGCTGTCCACATCACCTCCTTCTGGGACGAGCCTTGGTGCCGGGTGTGCCAGGCTGTACAGAGGGCTGGGGACCGGCCCAAGAGCATACGGAACTTGGCCAGCTGGTTCGAGCGGTGAAGCCGCGCTCCCCTGGAAGCGACCCAGGGGAGGCCAAGTTGTCAGCTTTTTGATCCTCTACTGTGCATCTCCTTGACTGCCGCATCATGGGAGTAAGTTCTTCAAACACCCATTTTTGCTCTATGGGAAAAAAACGATTTACCAATTAATATTACTCAGCACAGAGATGGGGGCCCGGTTTCCATATTTTTTGCACAGCTAGCAATTGGGCTCCCTTTGCTGCTGATGGGCATCATTGTTTAGGGGTGAAGGAGG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000196371

numer dostępu NCBI

NM_002033

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... FUT4(2526) , FUT4(2526)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
ACV
TNU
DOR

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Qin Zheng et al.
Cell death and differentiation, 24(12), 2161-2172 (2017-09-16)
Successful embryo implantation requires the establishment of a receptive endometrium. Poor endometrial receptivity has generally been considered as a major cause of infertility. Protein glycosylation is associated with many physiological and pathological processes. The fucosylation is catalyzed by the specific
X Yang et al.
Cell death & disease, 4, e735-e735 (2013-07-28)
Epithelial-mesenchymal transition (EMT) is a crucial step in tumor progression and has an important role during cancer invasion and metastasis. Although fucosyltransferase IV (FUT4) has been implicated in the modulation of cell migration, invasion and cancer metastasis, its role during
Xiaobin Feng et al.
Gene, 578(2), 232-241 (2015-12-25)
Fucosylation is the final step in the glycosylation machinery, which produces glycans involved in tumor multidrug resistance development. MicroRNAs (miRNAs) are endogenous negative regulators of gene expression and have been implicated in most cellular processes of tumors, including drug resistance.
Yang Li et al.
Cell death & disease, 8(6), e2892-e2892 (2017-06-24)
Metastasis is a multistep molecular network process, which is the major cause of death in patients with colorectal cancer (CRC). MicroRNAs (miRNAs) play pivotal roles in tumorigenesis as either tumor suppressors or oncogenes. Increased expression of fucosyltransferase4 (FUT4) has been
Ming Yu et al.
Scientific reports, 7(1), 5315-5315 (2017-07-15)
Glycosylation of uterine endometrial cells plays important roles to determine their receptive function to blastocysts. Trophoblast-derived pregnancy-associated plasma protein A (PAPPA) is specifically elevated in pregnant women serum, and is known to promote trophoblast cell proliferation and adhesion. However, the
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej