Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU003471

Sigma-Aldrich

MISSION® esiRNA

targeting human SRF

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ACGACCTTCAGCAAGAGGAAGACGGGCATCATGAAGAAGGCCTATGAGCTGTCCACGCTGACAGGGACACAGGTGCTGTTGCTGGTGGCCAGTGAGACAGGCCATGTGTATACCTTTGCCACCCGAAAACTGCAGCCCATGATCACCAGTGAGACCGGCAAGGCACTGATTCAGACCTGCCTCAACTCGCCAGACTCTCCACCCCGTTCAGACCCCACAACAGACCAGAGAATGAGTGCCACTGGCTTTGAAGAGACAGATCTCACCTACCAGGTGTCGGAGTCTGACAGCAGTGGGGAGACCAAGGACACACTGAAGCCGGCGTTCACAGTCACCAACCTGCCGGGTACAACCTCCACCATCCAAACAGCACCTAGCACCTCTACCACCATGCAAGTCAGCAGCGGCCCCTCCTTTCCCATCACCAACTACCTGGCACC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000112658

numer dostępu NCBI

NM_003131

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... SRF(6722) , SRF(6722)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hui Liu et al.
Stem cells international, 2016, 2524092-2524092 (2016-01-23)
Resveratrol (trans-3,5,4'-trihydroxystilbene) (RSV) is a natural polyphenol with protective effects over cardiac tissues and can affect cell survival and differentiation in cardiac stem cells transplantation. However, whether this agent can affect cardiomyocytes (CMs) differentiation of induced pluripotent stem cells (iPSCs)
Carolina Leimgruber et al.
Journal of cellular physiology, 232(10), 2806-2817 (2016-11-20)
Prostatic smooth muscle cells (pSMCs) differentiation is a key factor for prostatic homeostasis, with androgens exerting multiple effects on these cells. Here, we demonstrated that the myodifferentiator complex Srf/Myocd is up-regulated by testosterone in a dose-dependent manner in primary cultures
Qi Li et al.
PloS one, 8(9), e75470-e75470 (2013-09-24)
Transcriptional regulation is essential for any gene expression including microRNA expression. MiR-1-1 and miR-133a-2 are essential microRNAs (miRs) involved in cardiac and skeletal muscle development and diseases. Early studies reveal two regulatory enhancers, an upstream and an intragenic, that direct
Min-Seok Kim et al.
Scientific reports, 9(1), 4631-4631 (2019-03-16)
Methylmercury is an environmental pollutant that causes specific and serious damage to the central nervous system. We have previously shown that C-C motif chemokine ligand 4 (CCL4) protects cultured neural cells from methylmercury toxicity and expression of CCL4 is specifically
Xi He et al.
Oncology letters, 5(3), 819-824 (2013-02-22)
Recent studies indicate that serum response factor (SRF) is highly expressed in tumors such as hepatocellular, thyroid, esophageal and lung carcinoma. However, the expression and roles of SRF in esophageal squamous cell carcinoma (ESCC) are unclear. In this study, immunohistochemistry
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej