Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU002801

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGGTGGACATCACCAGAAGCTATAGCCTACCGCAAGTTCACGTCAGCCAGCGATGTATGGAGTTATGGGATTGTTCTCTGGGAGGTGATGTCTTATGGAGAGAGACCATACTGGGAGATGTCCAATCAGGATGTAATTAAAGCTGTAGATGAGGGCTATCGACTGCCACCCCCCATGGACTGCCCAGCTGCCTTGTATCAGCTGATGCTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTTGAGCAGATTGTTAGTATTCTGGACAAGCTTATCCGGAATCCCGGCAGCCTGAAGATCATCACCAGTGCAGCCGCAAGGCCATCAAACCTTCTTCTGGACCAAAGCAATGTGGATATCACTACCTTCCGCACAACAGGTGACTGGCTTAATGGTGTCTGGACAGCACACTGCAAGGAAATCTTCACGGGTGTG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000044524

numer dostępu NCBI

NM_005233

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... EPHA3(2042) , EPHA3(2042)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hemei Xiao et al.
Cell biology international (2018-04-17)
MicroRNAs (miRNAs) play key roles in cervical cancer metastasis progression. Accumulated evidences have revealed that miRNAs are related to the pathophysiological process. However, the role of miR-340 in cervical cancer and how it works is still not fully interpreted. Using
Song Hee Kim et al.
Cellular signalling, 47, 122-130 (2018-04-14)
Radiotherapy is a well-established therapeutic modality used in the treatment of many cancers. However, radioresistance remains a serious obstacle to successful treatment. Radioresistance can cause local recurrence and distant metastases in some patients after radiation treatment. Thus, many studies have
Xiaole Chen et al.
Molecular cancer research : MCR, 16(5), 909-919 (2018-02-18)
The Hedgehog (Hh) receptor Patched1 (PTCH1) is a well-known tumor suppressor that in its active form represses Smoothened (SMO) activity, inhibits proliferation, and induces apoptosis. The cytoplasmic C-terminal domain (CTD) regulates PTCH1 turnover and nucleates a proapoptotic complex. In this
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej