Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

Wyświetl całą dokumentację

EHU002711

Sigma-Aldrich

MISSION® esiRNA

targeting human BIRC2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GTGGCCTGATGCTGGATAACTGGAAACTAGGAGACAGTCCTATTCAAAAGCATAAACAGCTATATCCTAGCTGTAGCTTTATTCAGAATCTGGTTTCAGCTAGTCTGGGATCCACCTCTAAGAATACGTCTCCAATGAGAAACAGTTTTGCACATTCATTATCTCCCACCTTGGAACATAGTAGCTTGTTCAGTGGTTCTTACTCCAGCCTTTCTCCAAACCCTCTTAATTCTAGAGCAGTTGAAGACATCTCTTCATCGAGGACTAACCCCTACAGTTATGCAATGAGTACTGAAGAAGCCAGATTTCTTACCTACCATATGTGGCCATTAACTTTTTTGTCACCATCAGAATTGGCAAGAGCTGGTTTTTATTATATAGGACCTGGAGATAGGGTAGCCTGCTTTGCCTGTGGTGGGAAGCTCAGTAACTGGGAACCAAAGGATGATGCTATGTCAGAACACCGGAGGCATTTTCCCAACTGTCCATTTTTGGAAAATTCTCTAGAAACTCTGAGGTTTAGCATTTCAAATCTGAGCATGCAGACACATGCAGCTCGAAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000110330

numer dostępu NCBI

NM_001166

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... BIRC2(329) , BIRC2(329)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

12 - Non Combustible Liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
XZU
KXU
OWU
LXS
WGT

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Xin Wang et al.
International journal of developmental neuroscience : the official journal of the International Society for Developmental Neuroscience, 53, 10-17 (2016-05-26)
Bone morphogenic protein-7 (BMP7) is a multifunctional cytokine with demonstrated neurogenic potential. Oligodendrocytes (OLs) death after spinal cord injury (SCI) contributes to demyelination of spared axons, even leading to a permanent neurological deficit. Therefore, therapeutic approaches to prevent OLs death
M Lappas
Placenta, 35(10), 831-838 (2014-08-13)
Independent of their role in apoptosis, cellular inhibitors of apoptosis (cIAP) 1 and 2, have emerged as regulators of inflammation. Obesity in pregnancy is characterised by maternal and placental inflammation. Thus, the aim of this study was to determine the
Hong Jin et al.
Oncology research, 22(3), 167-176 (2015-07-15)
Emerging evidence suggests a potential role of cellular inhibitor of apoptosis protein 1 (cIAP1) in the development of human ovarian cancer. However, its function in the progression of ovarian cancer has not been clearly determined. Our study aimed to investigate
E-W Lee et al.
Cell death and differentiation, 22(9), 1463-1476 (2015-01-24)
Given their crucial role in apoptosis suppression, inhibitor of apoptosis proteins (IAPs) have recently become attractive targets for cancer therapy. Here, we report that cellular IAP2 (cIAP2) is specifically stabilized in several cancer cell lines, leading to resistance to Smac
Chung-Ming Lin et al.
Nanotechnology, 26(10), 105101-105101 (2015-02-20)
Benzo[a]pyrene (BaP), a component of cooking oil fumes (COF), promotes lung cancer cell proliferation and survival via the induction of inhibitor of apoptosis protein-2 (IAP-2) proteins. Thus knockdown of IAP-2 would be a promising way to battle against lung cancer

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej