Przejdź do zawartości
Merck

EHU001391

Sigma-Aldrich

MISSION® esiRNA

targeting human TMEM131

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGTCCAAGGACAAGGAACAACTGAGAACTTGAGGGTGGCAGGCAAGCTTCCAGGTCCAGGAAGCTCCTTACGCTTTAAAATCACGGAAGCATTGTTAAAAGATTGTACAGATAGTTTAAAACTAAGAGAACCAAATTTCACATTGAAAAGAACATTTAAGGTAGAGAATACAGGACAACTTCAAATTCACATAGAAACCATTGAAATCAGTGGATACTCATGTGAAGGATATGGCTTTAAAGTTGTTAATTGTCAAGAGTTTACTCTAAGTGCCAATGCTTCTAGAGATATAATCATATTGTTTACTCCTGATTTTACAGCTTCTAGAGTTATTCGGGAACTGAAGTTTATAACAACCAGTGGCTCTGAGTTTGTATTTATATTGAATGCATCCCTTCCTTACCATATGTTAGCAACCTGTGCAGAAGCCCTACCCAGACCT

Ensembl | numer dostępu dla gatunku człowiek

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Chao Wang et al.
Journal of cellular biochemistry, 119(2), 1646-1658 (2017-08-05)
The study elucidated the effects associated with silencing growth factor-β R1 (TGF-β R1) and TGF-β R2 genes on the proliferation and apoptosis of penile urethral epithelial cells (UECs) in hypospadiac male rats. Seventy-five male rats were distributed into the normal
Karl E Carlström et al.
Nature communications, 11(1), 4071-4071 (2020-08-15)
Arrest of oligodendrocyte (OL) differentiation and remyelination following myelin damage in multiple sclerosis (MS) is associated with neurodegeneration and clinical worsening. We show that Glutathione S-transferase 4α (Gsta4) is highly expressed during adult OL differentiation and that Gsta4 loss impairs
Yanjie Zhang et al.
Ecotoxicology and environmental safety, 179, 222-231 (2019-05-03)
Hydrogen sulfide (H2S), a multifunctional gasotransmitter, participates in a wide range of cellular signal transduction and pathophysiological processes. Cystathionine gamma-lyase (CSE) acts as a major H2S-generating enzyme in peripheral organs and tissues. As a cysteine-rich and heavy metal-binding protein, metallothionein-1
Yoav Elkis et al.
Nature communications, 8(1), 940-940 (2017-10-19)
Disruption of the reprogrammed energy management system of malignant cells is a prioritized goal of targeted cancer therapy. Two regulators of this system are the Fer kinase, and its cancer cell specific variant, FerT, both residing in subcellular compartments including
Shigemi Kimura et al.
Scientific reports, 4, 5066-5066 (2014-06-12)
The ZHTc6-MyoD embryonic stem cell line expresses the myogenic transcriptional factor MyoD under the control of a tetracycline-inducible promoter. Following induction, most of the ZHTc6-MyoD cells differentiate to myotubes. However, a small fraction does not differentiate, instead forming colonies that

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej