콘텐츠로 건너뛰기
Merck
모든 사진(1)

Key Documents

EHU148801

Sigma-Aldrich

MISSION® esiRNA

targeting human YBX1

로그인조직 및 계약 가격 보기
모든 사진(1)

About This Item

UNSPSC 코드:
41105324
NACRES:
NA.51

설명

Powered by Eupheria Biotech

Quality Level

100

제품 라인

MISSION®

형태

lyophilized powder

esiRNA cDNA 표적 서열

GGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATGCCGGCTTACCATCTCTACCATCATCCGGTTTAGTCATCCAACAAGAAGAAATATGAAATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCAGCATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAATTGTTTCATATCTGGTCAAGTTGAGATTTTTAAGAACTTCATTTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAAAGTCAACAAACTGCAAGCACCTG

Ensembl | 인체 수납 번호

ENSG00000065978

NCBI 수납 번호

NM_004559

배송 상태

ambient

저장 온도

−20°C

유전자 정보

human ... YBX1(4904) , YBX1(4904)

일반 설명

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

법적 정보

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point (°F)

Not applicable

Flash Point (°C)

Not applicable

시험 성적서(COA)

제품의 로트/배치 번호를 입력하여 시험 성적서(COA)을 검색하십시오. 로트 및 배치 번호는 제품 라벨에 있는 ‘로트’ 또는 ‘배치’라는 용어 뒤에서 찾을 수 있습니다.

이 제품을 이미 가지고 계십니까?

문서 라이브러리에서 최근에 구매한 제품에 대한 문서를 찾아보세요.

문서 라이브러리 방문

Cristina Pagano et al.
Oncotarget, 8(4), 6193-6205 (2016-12-23)
Correct spatial and temporal control of cell proliferation is of fundamental importance for tissue homeostasis. Its deregulation has been associated with several pathological conditions. In common with almost every aspect of plant and animal biology, cell proliferation is dominated by
Takahisa Yamashita et al.
International journal of oncology, 51(2), 579-586 (2017-07-18)
The development and acquisition of multiple drug resistance in cancer cells remain a major obstacle in the treatment of bladder cancer. Nuclear translocation of Y box binding-1 (YB-1), which is a member of a family of DNA-binding proteins that contain
Jia Pei Lim et al.
BMC cancer, 17(1), 201-201 (2017-03-18)
Y-box binding protein-1 is an evolutionary conserved transcription and translation regulating protein that is overexpressed in various human malignancies, including breast cancer. Despite reports of YB-1 and its association with distant spread of breast cancer, the intrinsic mechanism underlying this
Wen-Fei Xu et al.
Cell cycle (Georgetown, Tex.), 18(24), 3472-3490 (2019-11-13)
Protein kinase CK2 alpha (CK2α) is involved in the development of multiple malignancies. Overexpression of Y-box binding protein 1 (YBX1) is related to tumor proliferation, drug resistance, and poor prognosis. Studies have demonstrated that both CK2 and YBX1 could regulate
Xueming Cao et al.
Free radical biology & medicine, 141, 10-20 (2019-06-04)
Y-box protein 1 (YB1) is a key regulator of inflammatory mediators. However, the roles of YB1 in oxidized low-density lipoprotein (ox-LDL)-induced macrophage inflammation and lipid uptake remain less understood. Thus, we explored the roles of YB1 in ox-LDL-induced macrophage inflammation
모든 관련된 서류 보기

자사의 과학자팀은 생명 과학, 재료 과학, 화학 합성, 크로마토그래피, 분석 및 기타 많은 영역을 포함한 모든 과학 분야에 경험이 있습니다..

고객지원팀으로 연락바랍니다.